Transcript: Human NM_001303529.2

Homo sapiens tubulin beta 6 class V (TUBB6), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
TUBB6 (84617)
Length:
2137
CDS:
749..1651

Additional Resources:

NCBI RefSeq record:
NM_001303529.2
NBCI Gene record:
TUBB6 (84617)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116923 CAATGAGTCATCGTCTCAGAA pLKO.1 205 5UTR 100% 4.950 6.930 N TUBB6 n/a
2 TRCN0000415432 TAAACTTCACCTTCCATTAAG pLKO_005 1915 3UTR 100% 13.200 10.560 N TUBB6 n/a
3 TRCN0000420482 GATCGATGGATAGTCGGAATA pLKO_005 1639 CDS 100% 10.800 8.640 N TUBB6 n/a
4 TRCN0000415502 TGCAGCCAAGTCATGTAATTA pLKO_005 1778 3UTR 100% 15.000 10.500 N TUBB6 n/a
5 TRCN0000116924 CGGCCTGACAACTTCATCTTT pLKO.1 308 5UTR 100% 5.625 3.938 N TUBB6 n/a
6 TRCN0000116922 CCAGTCAGAAGATCACACCAT pLKO.1 1846 3UTR 100% 2.640 1.848 N TUBB6 n/a
7 TRCN0000116925 CGTCTCAGAAATATGTGCCCA pLKO.1 216 5UTR 100% 0.660 0.462 N TUBB6 n/a
8 TRCN0000116926 GAGTAAGAACAGCAGCTACTT pLKO.1 1312 CDS 100% 4.950 2.970 N TUBB6 n/a
9 TRCN0000090867 CCAGAGTAAGAACAGCAGCTA pLKO.1 1309 CDS 100% 2.640 1.584 N Tubb3 n/a
10 TRCN0000238808 AGACCTACTGCATCGACAATG pLKO_005 903 CDS 100% 10.800 5.400 Y Tubb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04404 pDONR223 100% 67.2% 67.2% None 0_1ins438 n/a
2 ccsbBroad304_04404 pLX_304 0% 67.2% 67.2% V5 0_1ins438 n/a
3 TRCN0000480164 TGTCGAGACCCGACGGGAATTTTT pLX_317 24.4% 67.2% 67.2% V5 0_1ins438 n/a
4 ccsbBroadEn_02415 pDONR223 100% 60.8% 62% None (many diffs) n/a
5 ccsbBroad304_02415 pLX_304 0% 60.8% 62% V5 (many diffs) n/a
6 TRCN0000469802 TTTCCTGATTTATTTGACTTAATT pLX_317 33.2% 60.8% 62% V5 (many diffs) n/a
7 TRCN0000488922 TAACTAAGCCACAGTTTAACTCGA pLX_317 26.8% 60.8% 62% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_07591 pDONR223 100% 60.7% 62.8% None (many diffs) n/a
9 ccsbBroad304_07591 pLX_304 0% 60.7% 62.8% V5 (many diffs) n/a
10 TRCN0000472336 CCGGAACAAGTAAACTGCTTATCA pLX_317 41.4% 60.7% 62.8% V5 (many diffs) n/a
11 ccsbBroadEn_05511 pDONR223 100% 60.5% 61.6% None (many diffs) n/a
12 ccsbBroad304_05511 pLX_304 0% 60.5% 61.6% V5 (many diffs) n/a
13 TRCN0000478420 AGGACATGACATCGGGCAGTTTCG pLX_317 18.3% 60.5% 61.6% V5 (many diffs) n/a
14 ccsbBroadEn_07109 pDONR223 100% 60.3% 61.4% None (many diffs) n/a
15 ccsbBroad304_07109 pLX_304 0% 60.3% 61.4% V5 (many diffs) n/a
16 TRCN0000470494 CAATTACAACATTCATCTATATAC pLX_317 29.5% 60.3% 61.4% V5 (many diffs) n/a
17 ccsbBroadEn_02416 pDONR223 100% 57.4% 61.6% None (many diffs) n/a
18 ccsbBroad304_02416 pLX_304 0% 57.4% 61.6% V5 (many diffs) n/a
19 TRCN0000466709 TCTCGCAGGACAGTTCGGCCAACT pLX_317 32.4% 57.4% 61.6% V5 (many diffs) n/a
20 ccsbBroadEn_05206 pDONR223 100% 55.7% 61.6% None (many diffs) n/a
21 ccsbBroad304_05206 pLX_304 0% 55.7% 61.6% V5 (many diffs) n/a
22 ccsbBroadEn_13398 pDONR223 100% 34.6% 36% None (many diffs) n/a
23 ccsbBroad304_13398 pLX_304 0% 34.6% 36% V5 (many diffs) n/a
24 TRCN0000466902 ACCACAGTACACCCTTGCTTCGCA pLX_317 100% 34.6% 36% V5 (many diffs) n/a
Download CSV