Transcript: Human NM_001289130.1

Homo sapiens tubulin beta 4A class IVa (TUBB4A), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
TUBB4A (10382)
Length:
2540
CDS:
546..1664

Additional Resources:

NCBI RefSeq record:
NM_001289130.1
NBCI Gene record:
TUBB4A (10382)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289130.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436665 ACTTCGTGTTTGGCCAATCCG pLKO_005 595 CDS 100% 2.640 3.696 N TUBB4A n/a
2 TRCN0000413593 GACCTATAAGTTCTGGTTTAT pLKO_005 2024 3UTR 100% 13.200 9.240 N TUBB4A n/a
3 TRCN0000029136 TGACCTGCAACTGGAGAGGAT pLKO.1 449 5UTR 100% 2.640 1.848 N TUBB4A n/a
4 TRCN0000029138 CAACGAGGCCACAGGAGGAAA pLKO.1 482 5UTR 100% 1.650 1.155 N TUBB4A n/a
5 TRCN0000029135 GCCGAGAGCTGCGACTGCCTT pLKO.1 699 CDS 100% 0.000 0.000 N TUBB4A n/a
6 TRCN0000029137 GCCGTCAACATGGTTCCCTTT pLKO.1 1089 CDS 100% 4.050 2.430 N TUBB4A n/a
7 TRCN0000029134 GCAACATGAATGACCTGGTAT pLKO.1 1567 CDS 100% 4.950 2.475 Y TUBB4A n/a
8 TRCN0000238808 AGACCTACTGCATCGACAATG pLKO_005 922 CDS 100% 10.800 5.400 Y Tubb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289130.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07591 pDONR223 100% 83.7% 83.7% None 0_1ins216;558T>C n/a
2 ccsbBroad304_07591 pLX_304 0% 83.7% 83.7% V5 0_1ins216;558T>C n/a
3 TRCN0000472336 CCGGAACAAGTAAACTGCTTATCA pLX_317 41.4% 83.7% 83.7% V5 0_1ins216;558T>C n/a
4 ccsbBroadEn_07109 pDONR223 100% 76.4% 80.2% None (many diffs) n/a
5 ccsbBroad304_07109 pLX_304 0% 76.4% 80.2% V5 (many diffs) n/a
6 TRCN0000470494 CAATTACAACATTCATCTATATAC pLX_317 29.5% 76.4% 80.2% V5 (many diffs) n/a
7 ccsbBroadEn_05511 pDONR223 100% 76.1% 80.4% None (many diffs) n/a
8 ccsbBroad304_05511 pLX_304 0% 76.1% 80.4% V5 (many diffs) n/a
9 TRCN0000478420 AGGACATGACATCGGGCAGTTTCG pLX_317 18.3% 76.1% 80.4% V5 (many diffs) n/a
10 ccsbBroadEn_02415 pDONR223 100% 75.1% 77.1% None (many diffs) n/a
11 ccsbBroad304_02415 pLX_304 0% 75.1% 77.1% V5 (many diffs) n/a
12 TRCN0000469802 TTTCCTGATTTATTTGACTTAATT pLX_317 33.2% 75.1% 77.1% V5 (many diffs) n/a
13 TRCN0000488922 TAACTAAGCCACAGTTTAACTCGA pLX_317 26.8% 75.1% 77.1% V5 (not translated due to prior stop codon) (many diffs) n/a
14 ccsbBroadEn_04404 pDONR223 100% 74.2% 78.2% None (many diffs) n/a
15 ccsbBroad304_04404 pLX_304 0% 74.2% 78.2% V5 (many diffs) n/a
16 TRCN0000480164 TGTCGAGACCCGACGGGAATTTTT pLX_317 24.4% 74.2% 78.2% V5 (many diffs) n/a
17 ccsbBroadEn_02416 pDONR223 100% 73.4% 82.4% None (many diffs) n/a
18 ccsbBroad304_02416 pLX_304 0% 73.4% 82.4% V5 (many diffs) n/a
19 TRCN0000466709 TCTCGCAGGACAGTTCGGCCAACT pLX_317 32.4% 73.4% 82.4% V5 (many diffs) n/a
20 ccsbBroadEn_05206 pDONR223 100% 70.6% 81.3% None (many diffs) n/a
21 ccsbBroad304_05206 pLX_304 0% 70.6% 81.3% V5 (many diffs) n/a
22 ccsbBroadEn_13398 pDONR223 100% 28.9% 31.3% None (many diffs) n/a
23 ccsbBroad304_13398 pLX_304 0% 28.9% 31.3% V5 (many diffs) n/a
24 TRCN0000466902 ACCACAGTACACCCTTGCTTCGCA pLX_317 100% 28.9% 31.3% V5 (many diffs) n/a
Download CSV