Transcript: Human NM_001013746.3

Homo sapiens zinc finger protein 107 (ZNF107), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
ZNF107 (51427)
Length:
5790
CDS:
518..2869

Additional Resources:

NCBI RefSeq record:
NM_001013746.3
NBCI Gene record:
ZNF107 (51427)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001013746.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428307 TAATTGATCCTACAAGCTTAC pLKO_005 2867 CDS 100% 6.000 8.400 N ZNF107 n/a
2 TRCN0000016658 GCCTTTAATCAATCCTATCAA pLKO.1 2027 CDS 100% 5.625 7.875 N ZNF107 n/a
3 TRCN0000416911 ACATATCCTCAAACCTTAATA pLKO_005 1362 CDS 100% 15.000 10.500 N ZNF107 n/a
4 TRCN0000016661 CCAACACTCAAACCTAATTAA pLKO.1 1699 CDS 100% 15.000 10.500 N ZNF107 n/a
5 TRCN0000016660 CGATTCTCAAACCTAACTATA pLKO.1 2372 CDS 100% 13.200 9.240 N ZNF107 n/a
6 TRCN0000422546 CTAAAGAGAAACTCAACAAAT pLKO_005 2073 CDS 100% 13.200 9.240 N ZNF107 n/a
7 TRCN0000415695 AGAACCTCTACAAGTGTAAAG pLKO_005 1239 CDS 100% 10.800 7.560 N ZNF107 n/a
8 TRCN0000433962 TCAAACATTACTAACCATAAG pLKO_005 2294 CDS 100% 10.800 7.560 N ZNF107 n/a
9 TRCN0000425492 TTTCTGCACACACGAGGTATT pLKO_005 2966 3UTR 100% 10.800 7.560 N ZNF107 n/a
10 TRCN0000434455 GAGAACCTCTACAAATTTGAA pLKO_005 2246 CDS 100% 5.625 3.938 N ZNF107 n/a
11 TRCN0000430707 GAGAAGACATACAGGAAACAA pLKO_005 802 CDS 100% 5.625 3.938 N ZNF107 n/a
12 TRCN0000422500 GACACTGAGAAGATACGGAAA pLKO_005 604 CDS 100% 4.050 2.835 N ZNF107 n/a
13 TRCN0000430522 CAGAGCTTTCAACCTATCCTC pLKO_005 2779 CDS 100% 2.640 1.848 N ZNF107 n/a
14 TRCN0000016662 CAGGAAACAAACACTTCAAAT pLKO.1 813 CDS 100% 13.200 7.920 N ZNF107 n/a
15 TRCN0000016659 CCCTACAAATGTGGAGATTAT pLKO.1 2756 CDS 100% 13.200 7.920 N ZNF107 n/a
16 TRCN0000414821 ACAACTTACTAGGCATAAGAT pLKO_005 1036 CDS 100% 5.625 3.375 N ZNF107 n/a
17 TRCN0000096054 CGGGAGAGAAACCTTACCAAT pLKO.1 2409 CDS 100% 4.950 2.970 N Zfp975 n/a
18 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1904 CDS 100% 15.000 7.500 Y ZNF443 n/a
19 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1904 CDS 100% 15.000 7.500 Y Zfp97 n/a
20 TRCN0000243748 CTGGAAAGAAACCCTACAAAT pLKO_005 3407 3UTR 100% 13.200 6.600 Y Gm6871 n/a
21 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1569 CDS 100% 13.200 6.600 Y Zfp934 n/a
22 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1569 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
23 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1569 CDS 100% 13.200 6.600 Y EG668616 n/a
24 TRCN0000146802 CCTCAAACCTTACTACACATA pLKO.1 2628 CDS 100% 4.950 2.475 Y ZNF714 n/a
25 TRCN0000016345 CCTCAAATCTTACTACACATA pLKO.1 2796 CDS 100% 4.950 2.475 Y ZNF254 n/a
26 TRCN0000149073 GCAAAGCCTTTAACCAGTCTT pLKO.1 1014 CDS 100% 4.950 2.475 Y ZNF714 n/a
27 TRCN0000240204 ATACGGGAGAGAAACCTTATG pLKO_005 2406 CDS 100% 10.800 5.400 Y EG665449 n/a
28 TRCN0000107875 CACTTGATTGTAGGTAAGATA pLKO.1 3785 3UTR 100% 5.625 2.813 Y ZNF254 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013746.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000477054 GAGCCAATTTATTAAACTTAACTA pLX_317 14.1% 99.9% 100% V5 2337G>A n/a
2 ccsbBroadEn_15067 pDONR223 92.3% 99.9% 97.9% None 2298_2299insA;2337G>A n/a
3 ccsbBroad304_15067 pLX_304 0% 99.9% 97.9% V5 (not translated due to prior stop codon) 2298_2299insA;2337G>A n/a
4 ccsbBroadEn_11232 pDONR223 100% 57% 48.7% None (many diffs) n/a
5 ccsbBroad304_11232 pLX_304 0% 57% 48.7% V5 (many diffs) n/a
6 TRCN0000476048 TACTATCCCAATAGAAACACCTCC pLX_317 21.8% 57% 48.7% V5 (many diffs) n/a
7 ccsbBroadEn_09784 pDONR223 100% 46.4% 39% None (many diffs) n/a
8 ccsbBroad304_09784 pLX_304 0% 46.4% 39% V5 (many diffs) n/a
9 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 46.4% 39% V5 (many diffs) n/a
10 ccsbBroadEn_15273 pDONR223 50.9% 42.6% 34.9% None (many diffs) n/a
11 ccsbBroad304_15273 pLX_304 0% 42.6% 34.9% V5 (many diffs) n/a
12 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 15.1% 12.2% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV