Transcript: Human NM_001025243.2

Homo sapiens interleukin 1 receptor associated kinase 1 (IRAK1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
IRAK1 (3654)
Length:
3344
CDS:
91..1992

Additional Resources:

NCBI RefSeq record:
NM_001025243.2
NBCI Gene record:
IRAK1 (3654)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146412 ACACGGTGTATGCTGTGAAG pXPR_003 AGG 714 38% 5 0.9096 IRAK1 IRAK1 76421
2 BRDN0001145800 AGGAGTACATCAAGACGGGA pXPR_003 AGG 1194 63% 9 0.5202 IRAK1 IRAK1 76418
3 BRDN0001147615 GATCAACCGCAACGCCCGTG pXPR_003 TGG 235 12% 2 0.3706 IRAK1 IRAK1 76419
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001025243.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121239 GAACACGGTGTATGCTGTGAA pLKO.1 786 CDS 100% 4.950 6.930 N IRAK1 n/a
2 TRCN0000342718 GAACACGGTGTATGCTGTGAA pLKO_005 786 CDS 100% 4.950 6.930 N IRAK1 n/a
3 TRCN0000121139 CCGCTTCTACAAAGTGATGGA pLKO.1 174 CDS 100% 2.640 3.696 N IRAK1 n/a
4 TRCN0000121240 CCAGCACTTCTTGTACGAGGT pLKO.1 135 CDS 100% 2.160 3.024 N IRAK1 n/a
5 TRCN0000121303 CGCAGGAGAACTCCTACGTGT pLKO.1 1478 CDS 100% 0.880 1.232 N IRAK1 n/a
6 TRCN0000000545 CGGGCAATTCAGTTTCTACAT pLKO.1 1060 CDS 100% 4.950 3.960 N IRAK1 n/a
7 TRCN0000121140 TCACCCAAACATTGTGGACTT pLKO.1 891 CDS 100% 4.050 3.240 N IRAK1 n/a
8 TRCN0000121305 AGTTCCAACGTCCTTCTGGAT pLKO.1 1117 CDS 100% 2.640 2.112 N IRAK1 n/a
9 TRCN0000000543 CCCTCCTACCTGCTTACAATT pLKO.1 2430 3UTR 100% 13.200 9.240 N IRAK1 n/a
10 TRCN0000342655 CCCTCCTACCTGCTTACAATT pLKO_005 2430 3UTR 100% 13.200 9.240 N IRAK1 n/a
11 TRCN0000195319 CTCATCCATGGAGACATCAAG pLKO.1 1096 CDS 100% 4.950 3.465 N IRAK1 n/a
12 TRCN0000121138 GCCACCGCAGATTATCATCAA pLKO.1 1821 CDS 100% 4.950 3.465 N IRAK1 n/a
13 TRCN0000342654 GCCACCGCAGATTATCATCAA pLKO_005 1821 CDS 100% 4.950 3.465 N IRAK1 n/a
14 TRCN0000121237 GTATGCTGTGAAGAGGCTGAA pLKO.1 795 CDS 100% 4.050 2.835 N IRAK1 n/a
15 TRCN0000000546 CATTGTGGACTTTGCTGGCTA pLKO.1 900 CDS 100% 2.640 1.848 N IRAK1 n/a
16 TRCN0000000547 AGGAGTACATCAAGACGGGAA pLKO.1 1268 CDS 100% 2.160 1.512 N IRAK1 n/a
17 TRCN0000199361 CCTTGGCAGCTCTGCATCATC pLKO.1 1791 CDS 100% 1.650 1.155 N IRAK1 n/a
18 TRCN0000121304 CCCGACAGAAGATGGTCCAGA pLKO.1 1847 CDS 100% 0.880 0.616 N IRAK1 n/a
19 TRCN0000199382 CACCCACAACTTCTCGGAGGA pLKO.1 714 CDS 100% 0.720 0.504 N IRAK1 n/a
20 TRCN0000000544 GCCCGAAGAAAGTGATGAATT pLKO.1 1962 CDS 100% 0.000 0.000 N IRAK1 n/a
21 TRCN0000121137 GCTGAAGTAGGAGGATCATTT pLKO.1 2647 3UTR 100% 13.200 7.920 N IRAK1 n/a
22 TRCN0000342719 GCTGAAGTAGGAGGATCATTT pLKO_005 2647 3UTR 100% 13.200 7.920 N IRAK1 n/a
23 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2481 3UTR 100% 4.950 2.475 Y ERAP2 n/a
24 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2482 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025243.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489613 CACCTTAGGGTACTTGCCGCTGTA pLX_317 14.4% 90.6% 90.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488845 GCTCGCGGTGCTCTGCTTGCCGTG pLX_317 10.8% 90.5% 90.4% V5 (many diffs) n/a
3 TRCN0000489710 TGTCAATGGTAATAGGAATCCGTG pLX_317 13.3% 88.9% 88.9% V5 (not translated due to prior stop codon) 1301_1302ins237 n/a
4 TRCN0000491566 TGCCAGATTATATCCTCATCCTCG pLX_317 14% 88.8% 88.7% V5 1301_1302ins237;1899_1900insG n/a
5 TRCN0000489381 TCACTGGGCAATGCCACGACGAAC pLX_317 13.6% 86.8% 90.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV