Transcript: Human NM_001080448.3

Homo sapiens EPH receptor A6 (EPHA6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
EPHA6 (285220)
Length:
16254
CDS:
31..3423

Additional Resources:

NCBI RefSeq record:
NM_001080448.3
NBCI Gene record:
EPHA6 (285220)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080448.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021418 CGTGAATTACACCTTTGAAAT pLKO.1 1536 CDS 100% 13.200 18.480 N EPHA6 n/a
2 TRCN0000195154 CTCGGAATATACTGGTCAATA pLKO.1 2714 CDS 100% 13.200 18.480 N EPHA6 n/a
3 TRCN0000001768 GCTCGGAATATACTGGTCAAT pLKO.1 2713 CDS 100% 4.950 6.930 N EPHA6 n/a
4 TRCN0000196394 GTAATGATTGTGGTGGAATAT pLKO.1 2551 CDS 100% 13.200 9.240 N EPHA6 n/a
5 TRCN0000021415 CCCAAGCCATTCACAGCTATT pLKO.1 1594 CDS 100% 10.800 7.560 N EPHA6 n/a
6 TRCN0000001770 CGTCATCCTCACTTTATTCTT pLKO.1 1998 CDS 100% 5.625 3.938 N EPHA6 n/a
7 TRCN0000195212 CTTTCTGATATGGGTTATGTT pLKO.1 2677 CDS 100% 5.625 3.938 N EPHA6 n/a
8 TRCN0000194829 CCAAACATCATTCGCCTAGAA pLKO.1 2380 CDS 100% 4.950 3.465 N EPHA6 n/a
9 TRCN0000021416 GCCATCACTGAAATGGATGAA pLKO.1 487 CDS 100% 4.950 3.465 N EPHA6 n/a
10 TRCN0000195213 CAACTTAGTATGCAAAGTTTC pLKO.1 2736 CDS 100% 1.080 0.756 N EPHA6 n/a
11 TRCN0000021417 CCTCAAACTCAACACTGAAAT pLKO.1 810 CDS 100% 13.200 7.920 N EPHA6 n/a
12 TRCN0000195580 CAGCAGAACAAGGACAGATTC pLKO.1 1937 CDS 100% 10.800 6.480 N EPHA6 n/a
13 TRCN0000196374 GCATCAGGCATGAAGTATCTT pLKO.1 2659 CDS 100% 5.625 3.375 N EPHA6 n/a
14 TRCN0000001771 GCAGCAGAACAAGGACAGATT pLKO.1 1936 CDS 100% 4.950 2.970 N EPHA6 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 9067 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 9067 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080448.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15300 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15300 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000489808 GCGAATCGTGCGTGGGCGGTAGCG pLX_317 35% 29.6% 26.8% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489560 TTCAAGTCGTGCGGGCTTGCCTCT pLX_317 32.2% 28.4% 26.8% V5 (many diffs) n/a
Download CSV