Transcript: Human NM_001100.4

Homo sapiens actin alpha 1, skeletal muscle (ACTA1), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
ACTA1 (58)
Length:
1491
CDS:
104..1237

Additional Resources:

NCBI RefSeq record:
NM_001100.4
NBCI Gene record:
ACTA1 (58)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001100.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117343 ACCCACAACGTGCCCATTTAT pLKO.1 587 CDS 100% 15.000 21.000 N ACTA1 n/a
2 TRCN0000437700 GACTTCTCAGGACGACGAATC pLKO_005 1260 3UTR 100% 6.000 8.400 N ACTA1 n/a
3 TRCN0000117342 CCGCAGTCACTTTCTTTGTAA pLKO.1 1315 3UTR 100% 5.625 7.875 N ACTA1 n/a
4 TRCN0000434513 TGTATGCCAACAACGTCATGT pLKO_005 987 CDS 100% 4.950 3.465 N ACTA1 n/a
5 TRCN0000117345 GACCACCTACAACAGCATCAT pLKO.1 937 CDS 100% 4.950 2.970 N ACTA1 n/a
6 TRCN0000117344 GCGCAAATACTCGGTGTGGAT pLKO.1 1111 CDS 100% 2.640 1.584 N ACTA1 n/a
7 TRCN0000117346 CATCACCAACTGGGATGACAT pLKO.1 334 CDS 100% 4.950 2.475 Y ACTA1 n/a
8 TRCN0000029409 CGAGAAGATGACCCAGATCAT pLKO.1 457 CDS 100% 4.950 2.475 Y ACTB n/a
9 TRCN0000276219 CGAGAAGATGACCCAGATCAT pLKO_005 457 CDS 100% 4.950 2.475 Y ACTB n/a
10 TRCN0000090902 CCAGATCATGTTTGAGACCTT pLKO.1 469 CDS 100% 2.640 1.320 Y Actb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001100.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13807 pDONR223 100% 99.9% 1.8% None 4delT n/a
2 ccsbBroad304_13807 pLX_304 0% 99.9% 1.8% V5 (not translated due to prior stop codon) 4delT n/a
3 TRCN0000475388 CAGGCCGACAGAGACACGAAATCC pLX_317 29.9% 99.9% 1.8% V5 (not translated due to prior stop codon) 4delT n/a
4 ccsbBroadEn_05764 pDONR223 100% 85.7% 93.1% None (many diffs) n/a
5 ccsbBroad304_05764 pLX_304 0% 85.7% 93.1% V5 (many diffs) n/a
6 TRCN0000466781 AATTGTGGTGCTTGTTGCCGCCTG pLX_317 31.7% 85.7% 93.1% V5 (many diffs) n/a
7 ccsbBroadEn_15351 pDONR223 0% 85.7% 93.1% None (many diffs) n/a
8 ccsbBroad304_15351 pLX_304 0% 85.7% 93.1% V5 (many diffs) n/a
9 ccsbBroadEn_05763 pDONR223 100% 85.7% 92.5% None (many diffs) n/a
10 ccsbBroad304_05763 pLX_304 53.1% 85.7% 92.5% V5 (many diffs) n/a
11 TRCN0000470279 TCAAGCCTGGAACGGGCTCACGTC pLX_317 31.7% 85.7% 92.5% V5 (many diffs) n/a
12 ccsbBroadEn_13808 pDONR223 100% 85.7% 92.5% None (many diffs) n/a
13 ccsbBroad304_13808 pLX_304 0% 85.7% 92.5% V5 (not translated due to frame shift) (many diffs) n/a
14 TRCN0000471742 AATGGGAGTTCTCACGTCAGGTCC pLX_317 44.8% 85.7% 92.5% V5 (not translated due to frame shift) (many diffs) n/a
15 ccsbBroadEn_00015 pDONR223 100% 85.6% 98.9% None (many diffs) n/a
16 ccsbBroad304_00015 pLX_304 0% 85.6% 98.9% V5 (many diffs) n/a
17 TRCN0000468012 TCTATATTCTTCCCTCACTCATAA pLX_317 37.9% 85.6% 98.9% V5 (many diffs) n/a
18 ccsbBroadEn_00014 pDONR223 100% 84.7% 97.8% None (many diffs) n/a
19 ccsbBroad304_00014 pLX_304 0% 84.7% 97.8% V5 (not translated due to prior stop codon) (many diffs) n/a
20 TRCN0000467679 GCTACTGCTTTGAGGGTTATAACT pLX_317 37.9% 84.7% 97.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV