Transcript: Human NM_001164417.3

Homo sapiens SSX family member 2B (SSX2B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SSX2B (727837)
Length:
1281
CDS:
88..654

Additional Resources:

NCBI RefSeq record:
NM_001164417.3
NBCI Gene record:
SSX2B (727837)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164417.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021665 CCCACCTTTCATGTGTAATAA pLKO.1 288 CDS 100% 15.000 7.500 Y SSX1 n/a
2 TRCN0000115725 CTCCCACCTTTCATGTGTAAT pLKO.1 286 CDS 100% 13.200 6.600 Y SSX9P n/a
3 TRCN0000115723 CTTCGATGATATTGCCAAATA pLKO.1 159 CDS 100% 13.200 6.600 Y SSX9P n/a
4 TRCN0000020146 CCTTCGATGATATTGCCAAAT pLKO.1 158 CDS 100% 10.800 5.400 Y SSX3 n/a
5 TRCN0000115839 CCAGCAGAGGAAGGAAATGAT pLKO.1 433 CDS 100% 5.625 2.813 Y SSX7 n/a
6 TRCN0000157378 CCAGCAGAGGAAGGAAATGAT pLKO.1 433 CDS 100% 5.625 2.813 Y SSX5 n/a
7 TRCN0000115724 CCTCCCACCTTTCATGTGTAA pLKO.1 285 CDS 100% 4.950 2.475 Y SSX9P n/a
8 TRCN0000021689 CCTGAGGAAGATGACGAGTAA pLKO.1 634 CDS 100% 4.950 2.475 Y SSX2 n/a
9 TRCN0000020147 GCTGGTGATTTATGAAGAGAT pLKO.1 606 CDS 100% 4.950 2.475 Y SSX3 n/a
10 TRCN0000157537 GTGTGCCAAGAGTTCGATGTT pLKO.1 809 3UTR 100% 4.950 2.475 Y SSX5 n/a
11 TRCN0000021692 GCCTTCGATGATATTGCCAAA pLKO.1 157 CDS 100% 4.050 2.025 Y SSX2 n/a
12 TRCN0000020148 GCCAAATACTTCTCTAAGGAA pLKO.1 172 CDS 100% 3.000 1.500 Y SSX3 n/a
13 TRCN0000115807 GCAAGTGTTCACAACAGTGAA pLKO.1 766 3UTR 100% 0.495 0.248 Y SSX6P n/a
14 TRCN0000152838 GCAAGTGTTCACAACAGTGAA pLKO.1 766 3UTR 100% 0.495 0.248 Y SSX5 n/a
15 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1087 3UTR 100% 4.950 2.475 Y KAAG1 n/a
16 TRCN0000157304 CGTGGGAATCAGGTTGAACAT pLKO.1 355 CDS 100% 4.950 2.475 Y SSX5 n/a
17 TRCN0000115722 GCCCATGATGAGAAGCAGAAT pLKO.1 678 3UTR 100% 4.950 2.475 Y SSX9P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164417.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487931 GACCATATAATGACCGGCCAGGGG pLX_317 48.5% 99.8% 100% V5 (not translated due to prior stop codon) 129G>A n/a
2 TRCN0000487987 CTCGTAAATATTTCCCCCGTTCGT pLX_317 48.3% 99.6% 99.4% V5 129G>A;564_565insG n/a
3 ccsbBroadEn_07001 pDONR223 100% 99.6% 99.4% None 129G>A;506G>C n/a
4 ccsbBroad304_07001 pLX_304 0% 99.6% 99.4% V5 129G>A;506G>C n/a
5 TRCN0000479224 GCACGATTCGGCACCAGTAAATTC pLX_317 64.8% 99.2% 98.9% V5 129G>A;199_200delCTinsTC;506G>C n/a
6 ccsbBroadEn_02358 pDONR223 100% 95.3% 90.9% None (many diffs) n/a
7 ccsbBroad304_02358 pLX_304 0% 95.3% 90.9% V5 (many diffs) n/a
8 TRCN0000472750 CCACTTCCGTACTCCCCGCTCGCG pLX_317 74.7% 95.3% 90.9% V5 (many diffs) n/a
9 ccsbBroadEn_07003 pDONR223 100% 91.1% 79.7% None (many diffs) n/a
10 ccsbBroad304_07003 pLX_304 0% 91.1% 79.7% V5 (many diffs) n/a
11 TRCN0000475229 CCACCCTATAATTCAACTACCTAC pLX_317 62.8% 91.1% 79.7% V5 (many diffs) n/a
12 ccsbBroadEn_01604 pDONR223 100% 89.2% 78.1% None (many diffs) n/a
13 ccsbBroad304_01604 pLX_304 0% 89.2% 78.1% V5 (many diffs) n/a
14 TRCN0000467573 GAGGTGCGGTAGTGGCTGTCGGAC pLX_317 86% 89.2% 78.1% V5 (many diffs) n/a
15 ccsbBroadEn_02357 pDONR223 100% 83.1% 70.3% None (many diffs) n/a
16 ccsbBroad304_02357 pLX_304 0% 83.1% 70.3% V5 (many diffs) n/a
17 TRCN0000479719 TGCAACAGTCTTCCTTTAACGATA pLX_317 61.3% 83.1% 70.3% V5 (many diffs) n/a
18 ccsbBroadEn_07002 pDONR223 100% 76.1% 68.5% None (many diffs) n/a
19 ccsbBroad304_07002 pLX_304 0% 76.1% 68.5% V5 (many diffs) n/a
20 TRCN0000470951 GTCCCTCCTCTCTTCTGCAACACA pLX_317 67.7% 76.1% 68.5% V5 (many diffs) n/a
21 ccsbBroadEn_01605 pDONR223 100% 73.6% 72% None 465_466ins146;524_564del n/a
22 ccsbBroad304_01605 pLX_304 0% 73.6% 72% V5 465_466ins146;524_564del n/a
23 TRCN0000479927 TTAGGGCCACATCTTTCATTTATA pLX_317 56.6% 73.6% 72% V5 465_466ins146;524_564del n/a
24 TRCN0000489622 TCTCTACATGTCCGATTTTAATCG pLX_317 50.9% 73.6% 71.6% V5 465_466ins146;524_564delinsG n/a
25 TRCN0000491259 ACCCAGTTTATTCAAGCATACCTT pLX_317 34.3% 73.6% 72% V5 (not translated due to prior stop codon) 465_466ins146;524_564del n/a
26 ccsbBroadEn_11160 pDONR223 100% 61.4% 40.1% None (many diffs) n/a
27 ccsbBroad304_11160 pLX_304 0% 61.4% 40.1% V5 (many diffs) n/a
28 TRCN0000466761 AGTGCTGCACGATATCGTACACTG pLX_317 72.1% 61.4% 40.1% V5 (many diffs) n/a
Download CSV