Transcript: Human NM_001202457.2

Homo sapiens zinc finger protein 816 (ZNF816), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
ZNF816 (125893)
Length:
2555
CDS:
171..2126

Additional Resources:

NCBI RefSeq record:
NM_001202457.2
NBCI Gene record:
ZNF816 (125893)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001202457.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147397 GTCAGAAATCATCCCTTCAAT pLKO.1 1306 CDS 100% 5.625 3.938 N ZNF816 n/a
2 TRCN0000147422 GTAACCAATTGGACAAGTCTA pLKO.1 700 CDS 100% 4.950 3.465 N ZNF816 n/a
3 TRCN0000018107 GCTGGAAACAAGCCTATTAAA pLKO.1 609 CDS 100% 15.000 7.500 Y ZNF600 n/a
4 TRCN0000149130 GCTGGAGAGAAACCTTACAAA pLKO.1 1680 CDS 100% 5.625 2.813 Y ZNF761 n/a
5 TRCN0000015887 GTGAAGAATGTGACAAAGTTT pLKO.1 1702 CDS 100% 5.625 2.813 Y ZNF702P n/a
6 TRCN0000146631 CCTCATTAGACATCAGAGAAT pLKO.1 2408 3UTR 100% 4.950 2.475 Y ZNF816 n/a
7 TRCN0000150044 CCTTGAAAGACATAGGAGAAT pLKO.1 1739 CDS 100% 4.950 2.475 Y ZNF816 n/a
8 TRCN0000148019 GCAAAGCCTTTACTTCATGTT pLKO.1 2383 3UTR 100% 4.950 2.475 Y ZNF816 n/a
9 TRCN0000015885 GCAATTCATACTGGAGAGAAA pLKO.1 1251 CDS 100% 4.950 2.475 Y ZNF702P n/a
10 TRCN0000141972 GCACAACATCAGAGAGTTCAT pLKO.1 1911 CDS 100% 4.950 2.475 Y ZNF468 n/a
11 TRCN0000149463 GCACGTCATCATAGACTTCAT pLKO.1 1659 CDS 100% 4.950 2.475 Y ZNF321P n/a
12 TRCN0000154835 GCAGAACATCAGAGAGTTCAT pLKO.1 1491 CDS 100% 4.950 2.475 Y ZNF320 n/a
13 TRCN0000150214 GTAATGAATGTGGCAAGGTTT pLKO.1 1618 CDS 100% 4.950 2.475 Y ZNF813 n/a
14 TRCN0000142023 GTAAGGTTTGTGACAAGGCTT pLKO.1 1786 CDS 100% 2.640 1.320 Y ZNF468 n/a
15 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1350 CDS 100% 4.950 2.475 Y ZNF28 n/a
16 TRCN0000147979 GCAATTCATACTGGAGAGAAT pLKO.1 1251 CDS 100% 4.950 2.475 Y ZNF321P n/a
17 TRCN0000148611 CGTAGACTTCATACTGGAGAA pLKO.1 1080 CDS 100% 4.050 2.025 Y ZNF761 n/a
18 TRCN0000149655 GCCCTTGTAATTCATAAGGCT pLKO.1 1233 CDS 100% 0.750 0.375 Y ZNF813 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001202457.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04800 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04800 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478315 CGTGCCTTGTCGAAGCCACGTTAA pLX_317 18.1% 100% 100% V5 n/a
4 ccsbBroadEn_05629 pDONR223 100% 21.4% 18.2% None (many diffs) n/a
5 ccsbBroad304_05629 pLX_304 0% 21.4% 18.2% V5 (many diffs) n/a
6 TRCN0000468214 TCTCTAGTACCTCAATAGGTGGTT pLX_317 94.7% 21.4% 18.2% V5 (many diffs) n/a
Download CSV