Transcript: Human NM_001271639.2

Homo sapiens zinc finger protein 138 (ZNF138), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ZNF138 (7697)
Length:
2579
CDS:
142..1101

Additional Resources:

NCBI RefSeq record:
NM_001271639.2
NBCI Gene record:
ZNF138 (7697)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271639.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429634 TAACAACTTACTGAACATAAG pLKO_005 1099 CDS 100% 10.800 7.560 N ZNF138 n/a
2 TRCN0000012919 CTGGTCCACAAACCTTTCTAA pLKO.1 756 CDS 100% 5.625 3.938 N ZNF138 n/a
3 TRCN0000012922 CACAAACCTTTCTAAACCTAA pLKO.1 762 CDS 100% 4.950 3.465 N ZNF138 n/a
4 TRCN0000414608 GCGGAATGTATATAGGCATGT pLKO_005 216 CDS 100% 4.050 2.835 N ZNF138 n/a
5 TRCN0000421902 ACAATGTGGCAAGGTCTTTAA pLKO_005 987 CDS 100% 13.200 7.920 N ZNF138 n/a
6 TRCN0000434325 ACACTGTGGCAAAGCCTTTAA pLKO_005 903 CDS 100% 13.200 7.920 N ZNF138 n/a
7 TRCN0000424428 ACCTTACTAGACATAAGATAA pLKO_005 935 CDS 100% 13.200 7.920 N ZNF138 n/a
8 TRCN0000413885 AGCTCACTGAACATAAGTTAA pLKO_005 1271 3UTR 100% 13.200 7.920 N ZNF138 n/a
9 TRCN0000417549 CAATCCTCAATCCTTACTAAA pLKO_005 841 CDS 100% 13.200 7.920 N ZNF138 n/a
10 TRCN0000012920 CCCTTACTAAACATCAGATAA pLKO.1 1019 CDS 100% 13.200 7.920 N ZNF138 n/a
11 TRCN0000422662 TTCACGCCTAACTCAACATAA pLKO_005 678 CDS 100% 13.200 7.920 N ZNF138 n/a
12 TRCN0000420316 AGAATGTGACAAATCACTTTG pLKO_005 651 CDS 100% 10.800 6.480 N ZNF138 n/a
13 TRCN0000012918 CCTCAACTCTTATTACACATA pLKO.1 1433 3UTR 100% 4.950 2.970 N ZNF138 n/a
14 TRCN0000428574 CTGAAGAGAAACCCTACAAAT pLKO_005 962 CDS 100% 13.200 6.600 Y ZNF138 n/a
15 TRCN0000107875 CACTTGATTGTAGGTAAGATA pLKO.1 2347 3UTR 100% 5.625 2.813 Y ZNF254 n/a
16 TRCN0000017702 CCCTGGAATATGAAGAGACAT pLKO.1 304 CDS 100% 4.950 2.475 Y ZNF430 n/a
17 TRCN0000019457 CCTCACACCTTACTAGACATA pLKO.1 929 CDS 100% 4.950 2.475 Y ZNF681 n/a
18 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 237 CDS 100% 4.950 2.475 Y ZNF493 n/a
19 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1639 3UTR 100% 4.950 2.475 Y ZNF28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271639.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11235 pDONR223 100% 53.9% 53.9% None 1_441del n/a
2 ccsbBroad304_11235 pLX_304 0% 53.9% 53.9% V5 1_441del n/a
3 TRCN0000481650 TTTATCAAAGGAATCCCCAATTTT pLX_317 100% 53.9% 53.9% V5 1_441del n/a
4 ccsbBroadEn_15278 pDONR223 59.5% 46.4% 40.8% None (many diffs) n/a
5 ccsbBroad304_15278 pLX_304 0% 46.4% 40.8% V5 (many diffs) n/a
6 ccsbBroadEn_11550 pDONR223 100% 45.5% 40.2% None (many diffs) n/a
7 ccsbBroad304_11550 pLX_304 0% 45.5% 40.2% V5 (many diffs) n/a
8 ccsbBroadEn_11232 pDONR223 100% 37.3% 30.6% None (many diffs) n/a
9 ccsbBroad304_11232 pLX_304 0% 37.3% 30.6% V5 (many diffs) n/a
10 TRCN0000476048 TACTATCCCAATAGAAACACCTCC pLX_317 21.8% 37.3% 30.6% V5 (many diffs) n/a
11 TRCN0000477054 GAGCCAATTTATTAAACTTAACTA pLX_317 14.1% 25.8% 21.9% V5 (many diffs) n/a
12 ccsbBroadEn_15067 pDONR223 92.3% 25.8% 22.1% None (many diffs) n/a
13 ccsbBroad304_15067 pLX_304 0% 25.8% 22.1% V5 (not translated due to prior stop codon) (many diffs) n/a
14 ccsbBroadEn_15729 pDONR223 0% 19.9% 17.9% None (many diffs) n/a
15 ccsbBroad304_15729 pLX_304 0% 19.9% 17.9% V5 (many diffs) n/a
16 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 19.9% 17.9% V5 (many diffs) n/a
17 ccsbBroadEn_11384 pDONR223 100% 19.9% 17.1% None (many diffs) n/a
18 ccsbBroad304_11384 pLX_304 0% 19.9% 17.1% V5 (many diffs) n/a
19 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 19.9% 17.1% V5 (many diffs) n/a
Download CSV