Transcript: Human NM_001271848.1

Homo sapiens zinc finger protein 700 (ZNF700), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
ZNF700 (90592)
Length:
2901
CDS:
144..2381

Additional Resources:

NCBI RefSeq record:
NM_001271848.1
NBCI Gene record:
ZNF700 (90592)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147698 GAGTGTATTCTAGTTCCGTTT pLKO.1 2601 3UTR 100% 4.050 5.670 N ZNF700 n/a
2 TRCN0000148041 GAGTGACCAGAACATTGAATA pLKO.1 353 CDS 100% 13.200 9.240 N ZNF700 n/a
3 TRCN0000147630 GCATTTGCATATACCAGTTCT pLKO.1 1092 CDS 100% 4.950 3.465 N ZNF700 n/a
4 TRCN0000149237 GATGTTGCAATTCCCTTCGAT pLKO.1 1789 CDS 100% 3.000 2.100 N ZNF700 n/a
5 TRCN0000146928 CTTGGGAGAAACTCTATGAAT pLKO.1 2727 3UTR 100% 5.625 3.375 N ZNF700 n/a
6 TRCN0000148203 GCCAAGTCATTTCAAACACAT pLKO.1 1272 CDS 100% 4.950 2.970 N ZNF700 n/a
7 TRCN0000243739 GAATGTAAACAATGTGGTAAA pLKO_005 903 CDS 100% 10.800 5.400 Y Gm14411 n/a
8 TRCN0000146416 CTGGAGTGAAACCCTATGAAT pLKO.1 2643 3UTR 100% 5.625 2.813 Y ZNF700 n/a
9 TRCN0000151775 CCCTATGAATGTAAGGAATGT pLKO.1 1485 CDS 100% 4.950 2.475 Y ZNF829 n/a
10 TRCN0000015600 GCTGGATATTTCCCAGAAGAA pLKO.1 272 CDS 100% 4.950 2.475 Y ZNF439 n/a
11 TRCN0000154837 GAAGACAGTCATTGTGGAGAA pLKO.1 438 CDS 100% 4.050 2.025 Y ZNF763 n/a
12 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 1491 CDS 100% 4.050 2.025 Y ZNF700 n/a
13 TRCN0000147730 GAATGTAAGGATTGTGGGAAA pLKO.1 2349 CDS 100% 4.050 2.025 Y ZNF700 n/a
14 TRCN0000149677 GATGCTGGAAACTTTCAGGAA pLKO.1 308 CDS 100% 2.640 1.320 Y ZNF69 n/a
15 TRCN0000156989 GCTGGAAACTTTCAGGAACCT pLKO.1 311 CDS 100% 2.640 1.320 Y ZNF763 n/a
16 TRCN0000107953 GCTGTGAACTTCACCCAGGAA pLKO.1 240 CDS 100% 2.640 1.320 Y ZNF799 n/a
17 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1475 CDS 100% 13.200 6.600 Y Zfp977 n/a
18 TRCN0000160334 CCTATGAATGTAAGGAATGTA pLKO.1 1486 CDS 100% 5.625 2.813 Y ZNF570 n/a
19 TRCN0000164599 CGGGAGAGAAACCCTATGAAT pLKO.1 2584 3UTR 100% 5.625 2.813 Y ZNF570 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15236 pDONR223 77.6% 71.5% 53.8% None (many diffs) n/a
2 ccsbBroad304_15236 pLX_304 0% 71.5% 53.8% V5 (many diffs) n/a
3 TRCN0000471005 ACATCAGGGGTCAATTGTCCTCTC pLX_317 27.5% 54.9% 49.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_15207 pDONR223 64.2% 43.9% 38.3% None (many diffs) n/a
5 ccsbBroad304_15207 pLX_304 0% 43.9% 38.3% V5 (many diffs) n/a
6 TRCN0000479573 TCAACGTGAACCTTCGTTCCTCGT pLX_317 53.6% 26.2% 23.6% V5 (not translated due to frame shift) (many diffs) n/a
7 ccsbBroadEn_01804 pDONR223 100% 18.7% 17.5% None (many diffs) n/a
8 ccsbBroad304_01804 pLX_304 0% 18.7% 17.5% V5 (many diffs) n/a
Download CSV