Transcript: Human NM_001278552.1

Homo sapiens tubulin alpha 4a (TUBA4A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
TUBA4A (7277)
Length:
2499
CDS:
557..1858

Additional Resources:

NCBI RefSeq record:
NM_001278552.1
NBCI Gene record:
TUBA4A (7277)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278552.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442868 AGCAGCTCATCACTGGGAAAG pLKO_005 780 CDS 100% 6.000 4.200 N TUBA4A n/a
2 TRCN0000072400 GCCCGTGGTCACTATACCATT pLKO.1 821 CDS 100% 4.950 3.465 N TUBA4A n/a
3 TRCN0000072398 GCCTACGGTCATTGATGAGAT pLKO.1 724 CDS 100% 4.950 3.465 N TUBA4A n/a
4 TRCN0000438345 TCATTGACCCAGTGCTGGATC pLKO_005 852 CDS 100% 4.050 2.835 N TUBA4A n/a
5 TRCN0000072399 GCTCTCTGTTGACTATGGCAA pLKO.1 979 CDS 100% 2.640 1.848 N TUBA4A n/a
6 TRCN0000072401 TCTGTGAAACTGGTGCTGGAA pLKO.1 669 CDS 100% 2.640 1.848 N TUBA4A n/a
7 TRCN0000420485 TGCCTGCTGTACCGTGGAGAT pLKO_005 1457 CDS 100% 1.350 0.945 N TUBA4A n/a
8 TRCN0000437048 GTCGAGCCCTACAACTCTATC pLKO_005 1055 CDS 100% 10.800 6.480 N TUBA4A n/a
9 TRCN0000072402 GTGGACAACGAAGCAATCTAT pLKO.1 1121 CDS 100% 5.625 3.375 N TUBA4A n/a
10 TRCN0000117105 CCAACCTCAATCGCCTCATTA pLKO.1 1185 CDS 100% 13.200 6.600 Y TUBA4B n/a
11 TRCN0000248506 CCATTGGCAAGGAGATCATTG pLKO_005 837 CDS 100% 10.800 5.400 Y Tuba1c n/a
12 TRCN0000152522 GAGAAGGATTATGAGGAGGTT pLKO.1 1796 CDS 100% 2.640 1.320 Y TUBA1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278552.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07108 pDONR223 100% 96.5% 96.6% None 0_1ins45;1299A>G n/a
2 ccsbBroad304_07108 pLX_304 0% 96.5% 96.6% V5 0_1ins45;1299A>G n/a
3 TRCN0000467865 AGTTCGTGAAACATACGCCGGCAG pLX_317 34.6% 96.5% 96.6% V5 0_1ins45;1299A>G n/a
4 ccsbBroadEn_15706 pDONR223 0% 82.8% 93.1% None (many diffs) n/a
5 ccsbBroad304_15706 pLX_304 0% 82.8% 93.1% V5 (many diffs) n/a
6 TRCN0000472335 TTCTGAAATAAGACACGCCGGGCA pLX_317 37.9% 82.8% 93.1% V5 (many diffs) n/a
7 ccsbBroadEn_02413 pDONR223 100% 82.8% 93.1% None (many diffs) n/a
8 ccsbBroad304_02413 pLX_304 0% 82.8% 93.1% V5 (many diffs) n/a
9 TRCN0000466437 GGCACCAGGAAACTAGGGGTGTGT pLX_317 31.7% 82.8% 93.1% V5 (many diffs) n/a
10 ccsbBroadEn_15707 pDONR223 0% 82.7% 93.1% None (many diffs) n/a
11 ccsbBroad304_15707 pLX_304 0% 82.7% 93.1% V5 (many diffs) n/a
12 TRCN0000467476 CACCGTCGAGGCCGCTGTATAAGA pLX_317 31.7% 82.7% 93.1% V5 (many diffs) n/a
13 ccsbBroadEn_16042 pDONR223 0% 82.4% 92.8% None (many diffs) n/a
14 ccsbBroad304_16042 pLX_304 0% 82.4% 92.8% V5 (many diffs) n/a
15 ccsbBroadEn_16043 pDONR223 0% 82.3% 92.8% None (many diffs) n/a
16 ccsbBroad304_16043 pLX_304 0% 82.3% 92.8% V5 (many diffs) n/a
17 TRCN0000465274 AATTCTCGGGCCTTAAGCACTAAC pLX_317 23.4% 82.3% 92.8% V5 (many diffs) n/a
18 ccsbBroadEn_09222 pDONR223 100% 82.2% 92.8% None (many diffs) n/a
19 ccsbBroad304_09222 pLX_304 0% 82.2% 92.8% V5 (many diffs) n/a
20 ccsbBroadEn_01831 pDONR223 100% 81.6% 92.6% None (many diffs) n/a
21 ccsbBroad304_01831 pLX_304 0% 81.6% 92.6% V5 (many diffs) n/a
22 TRCN0000466264 GACTTCAAATAAATAGCTTCACTC pLX_317 23.8% 81.6% 92.6% V5 (many diffs) n/a
23 ccsbBroadEn_09386 pDONR223 100% 81.1% 90.8% None (many diffs) n/a
24 ccsbBroad304_09386 pLX_304 0% 81.1% 90.8% V5 (many diffs) n/a
25 TRCN0000465924 GTCATGGAGAAAGTCGGTGACCGG pLX_317 28.5% 81.1% 90.8% V5 (many diffs) n/a
26 ccsbBroadEn_09375 pDONR223 100% 80.6% 90% None (many diffs) n/a
27 ccsbBroad304_09375 pLX_304 0% 80.6% 90% V5 (many diffs) n/a
28 TRCN0000469142 GAGGCCACAGGCCATAAACTAATT pLX_317 29% 80.6% 90% V5 (many diffs) n/a
29 ccsbBroadEn_15708 pDONR223 0% 60.4% 67.8% None (many diffs) n/a
Download CSV