Transcript: Human NM_001278697.1

Homo sapiens SSX family member 2 (SSX2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
SSX2 (6757)
Length:
1426
CDS:
137..781

Additional Resources:

NCBI RefSeq record:
NM_001278697.1
NBCI Gene record:
SSX2 (6757)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278697.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021665 CCCACCTTTCATGTGTAATAA pLKO.1 337 CDS 100% 15.000 7.500 Y SSX1 n/a
2 TRCN0000115725 CTCCCACCTTTCATGTGTAAT pLKO.1 335 CDS 100% 13.200 6.600 Y SSX9P n/a
3 TRCN0000115723 CTTCGATGATATTGCCAAATA pLKO.1 208 CDS 100% 13.200 6.600 Y SSX9P n/a
4 TRCN0000020146 CCTTCGATGATATTGCCAAAT pLKO.1 207 CDS 100% 10.800 5.400 Y SSX3 n/a
5 TRCN0000436080 AGTCAGAACACACACAACATT pLKO_005 659 CDS 100% 5.625 2.813 Y SSX2 n/a
6 TRCN0000115839 CCAGCAGAGGAAGGAAATGAT pLKO.1 482 CDS 100% 5.625 2.813 Y SSX7 n/a
7 TRCN0000157378 CCAGCAGAGGAAGGAAATGAT pLKO.1 482 CDS 100% 5.625 2.813 Y SSX5 n/a
8 TRCN0000433034 CACGAGAGATCTGGAAATAGG pLKO_005 590 CDS 100% 4.950 2.475 Y SSX2 n/a
9 TRCN0000115724 CCTCCCACCTTTCATGTGTAA pLKO.1 334 CDS 100% 4.950 2.475 Y SSX9P n/a
10 TRCN0000021689 CCTGAGGAAGATGACGAGTAA pLKO.1 761 CDS 100% 4.950 2.475 Y SSX2 n/a
11 TRCN0000020147 GCTGGTGATTTATGAAGAGAT pLKO.1 733 CDS 100% 4.950 2.475 Y SSX3 n/a
12 TRCN0000157537 GTGTGCCAAGAGTTCGATGTT pLKO.1 936 3UTR 100% 4.950 2.475 Y SSX5 n/a
13 TRCN0000021692 GCCTTCGATGATATTGCCAAA pLKO.1 206 CDS 100% 4.050 2.025 Y SSX2 n/a
14 TRCN0000020148 GCCAAATACTTCTCTAAGGAA pLKO.1 221 CDS 100% 3.000 1.500 Y SSX3 n/a
15 TRCN0000115807 GCAAGTGTTCACAACAGTGAA pLKO.1 893 3UTR 100% 0.495 0.248 Y SSX6P n/a
16 TRCN0000152838 GCAAGTGTTCACAACAGTGAA pLKO.1 893 3UTR 100% 0.495 0.248 Y SSX5 n/a
17 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1214 3UTR 100% 4.950 2.475 Y KAAG1 n/a
18 TRCN0000157304 CGTGGGAATCAGGTTGAACAT pLKO.1 404 CDS 100% 4.950 2.475 Y SSX5 n/a
19 TRCN0000115722 GCCCATGATGAGAAGCAGAAT pLKO.1 805 3UTR 100% 4.950 2.475 Y SSX9P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278697.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487931 GACCATATAATGACCGGCCAGGGG pLX_317 48.5% 87.6% 87.8% V5 (not translated due to prior stop codon) 129G>A;465_542del n/a
2 TRCN0000487987 CTCGTAAATATTTCCCCCGTTCGT pLX_317 48.3% 87.5% 87.4% V5 129G>A;465_542del;642_643insG n/a
3 ccsbBroadEn_07001 pDONR223 100% 87.5% 87.3% None 129G>A;465_542del;584G>C n/a
4 ccsbBroad304_07001 pLX_304 0% 87.5% 87.3% V5 129G>A;465_542del;584G>C n/a
5 TRCN0000479224 GCACGATTCGGCACCAGTAAATTC pLX_317 64.8% 87.2% 86.9% V5 (many diffs) n/a
6 ccsbBroadEn_01605 pDONR223 100% 84.6% 75.7% None 543_544ins68;602_642del n/a
7 ccsbBroad304_01605 pLX_304 0% 84.6% 75.7% V5 543_544ins68;602_642del n/a
8 TRCN0000479927 TTAGGGCCACATCTTTCATTTATA pLX_317 56.6% 84.6% 75.7% V5 543_544ins68;602_642del n/a
9 TRCN0000489622 TCTCTACATGTCCGATTTTAATCG pLX_317 50.9% 84.6% 75.7% V5 543_544ins68;602_642delinsG n/a
10 TRCN0000491259 ACCCAGTTTATTCAAGCATACCTT pLX_317 34.3% 84.6% 75.7% V5 (not translated due to prior stop codon) 543_544ins68;602_642del n/a
11 ccsbBroadEn_02358 pDONR223 100% 83.8% 79.9% None (many diffs) n/a
12 ccsbBroad304_02358 pLX_304 0% 83.8% 79.9% V5 (many diffs) n/a
13 TRCN0000472750 CCACTTCCGTACTCCCCGCTCGCG pLX_317 74.7% 83.8% 79.9% V5 (many diffs) n/a
14 ccsbBroadEn_07003 pDONR223 100% 80% 70% None (many diffs) n/a
15 ccsbBroad304_07003 pLX_304 0% 80% 70% V5 (many diffs) n/a
16 TRCN0000475229 CCACCCTATAATTCAACTACCTAC pLX_317 62.8% 80% 70% V5 (many diffs) n/a
17 ccsbBroadEn_01604 pDONR223 100% 78.4% 68.6% None (many diffs) n/a
18 ccsbBroad304_01604 pLX_304 0% 78.4% 68.6% V5 (many diffs) n/a
19 TRCN0000467573 GAGGTGCGGTAGTGGCTGTCGGAC pLX_317 86% 78.4% 68.6% V5 (many diffs) n/a
20 ccsbBroadEn_02357 pDONR223 100% 73.9% 63.2% None (many diffs) n/a
21 ccsbBroad304_02357 pLX_304 0% 73.9% 63.2% V5 (many diffs) n/a
22 TRCN0000479719 TGCAACAGTCTTCCTTTAACGATA pLX_317 61.3% 73.9% 63.2% V5 (many diffs) n/a
23 ccsbBroadEn_07002 pDONR223 100% 68.3% 61.5% None (many diffs) n/a
24 ccsbBroad304_07002 pLX_304 0% 68.3% 61.5% V5 (many diffs) n/a
25 TRCN0000470951 GTCCCTCCTCTCTTCTGCAACACA pLX_317 67.7% 68.3% 61.5% V5 (many diffs) n/a
26 ccsbBroadEn_11160 pDONR223 100% 54.3% 35.6% None (many diffs) n/a
27 ccsbBroad304_11160 pLX_304 0% 54.3% 35.6% V5 (many diffs) n/a
28 TRCN0000466761 AGTGCTGCACGATATCGTACACTG pLX_317 72.1% 54.3% 35.6% V5 (many diffs) n/a
Download CSV