Transcript: Human NM_001278701.2

Homo sapiens SSX family member 2B (SSX2B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
SSX2B (727837)
Length:
1427
CDS:
88..759

Additional Resources:

NCBI RefSeq record:
NM_001278701.2
NBCI Gene record:
SSX2B (727837)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278701.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021665 CCCACCTTTCATGTGTAATAA pLKO.1 288 CDS 100% 15.000 7.500 Y SSX1 n/a
2 TRCN0000115725 CTCCCACCTTTCATGTGTAAT pLKO.1 286 CDS 100% 13.200 6.600 Y SSX9P n/a
3 TRCN0000115723 CTTCGATGATATTGCCAAATA pLKO.1 159 CDS 100% 13.200 6.600 Y SSX9P n/a
4 TRCN0000020146 CCTTCGATGATATTGCCAAAT pLKO.1 158 CDS 100% 10.800 5.400 Y SSX3 n/a
5 TRCN0000436080 AGTCAGAACACACACAACATT pLKO_005 610 CDS 100% 5.625 2.813 Y SSX2 n/a
6 TRCN0000115839 CCAGCAGAGGAAGGAAATGAT pLKO.1 433 CDS 100% 5.625 2.813 Y SSX7 n/a
7 TRCN0000157378 CCAGCAGAGGAAGGAAATGAT pLKO.1 433 CDS 100% 5.625 2.813 Y SSX5 n/a
8 TRCN0000416077 ACATTGGTCGATTCAGTTTGT pLKO_005 626 CDS 100% 4.950 2.475 Y SSX2 n/a
9 TRCN0000021690 CACACACAACATTGGTCGATT pLKO.1 618 CDS 100% 4.950 2.475 Y SSX2 n/a
10 TRCN0000433034 CACGAGAGATCTGGAAATAGG pLKO_005 541 CDS 100% 4.950 2.475 Y SSX2 n/a
11 TRCN0000115724 CCTCCCACCTTTCATGTGTAA pLKO.1 285 CDS 100% 4.950 2.475 Y SSX9P n/a
12 TRCN0000021689 CCTGAGGAAGATGACGAGTAA pLKO.1 780 3UTR 100% 4.950 2.475 Y SSX2 n/a
13 TRCN0000021691 CGATTCAGTTTGTCAACTTCT pLKO.1 634 CDS 100% 4.950 2.475 Y SSX2 n/a
14 TRCN0000020147 GCTGGTGATTTATGAAGAGAT pLKO.1 752 CDS 100% 4.950 2.475 Y SSX3 n/a
15 TRCN0000157537 GTGTGCCAAGAGTTCGATGTT pLKO.1 955 3UTR 100% 4.950 2.475 Y SSX5 n/a
16 TRCN0000021692 GCCTTCGATGATATTGCCAAA pLKO.1 157 CDS 100% 4.050 2.025 Y SSX2 n/a
17 TRCN0000021693 TACACACAACAGGGACCCAAA pLKO.1 687 CDS 100% 4.050 2.025 Y SSX2 n/a
18 TRCN0000020148 GCCAAATACTTCTCTAAGGAA pLKO.1 172 CDS 100% 3.000 1.500 Y SSX3 n/a
19 TRCN0000115807 GCAAGTGTTCACAACAGTGAA pLKO.1 912 3UTR 100% 0.495 0.248 Y SSX6P n/a
20 TRCN0000152838 GCAAGTGTTCACAACAGTGAA pLKO.1 912 3UTR 100% 0.495 0.248 Y SSX5 n/a
21 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1233 3UTR 100% 4.950 2.475 Y KAAG1 n/a
22 TRCN0000157304 CGTGGGAATCAGGTTGAACAT pLKO.1 355 CDS 100% 4.950 2.475 Y SSX5 n/a
23 TRCN0000115722 GCCCATGATGAGAAGCAGAAT pLKO.1 824 3UTR 100% 4.950 2.475 Y SSX9P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278701.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01605 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01605 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479927 TTAGGGCCACATCTTTCATTTATA pLX_317 56.6% 100% 100% V5 n/a
4 TRCN0000491259 ACCCAGTTTATTCAAGCATACCTT pLX_317 34.3% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000489622 TCTCTACATGTCCGATTTTAATCG pLX_317 50.9% 99.8% 99.5% V5 669_670insG n/a
6 TRCN0000487931 GACCATATAATGACCGGCCAGGGG pLX_317 48.5% 73.5% 72% V5 (not translated due to prior stop codon) 129G>A;466_611del;669_670ins41 n/a
7 TRCN0000487987 CTCGTAAATATTTCCCCCGTTCGT pLX_317 48.3% 73.4% 72% V5 129G>A;466_611del;669_670ins42 n/a
8 ccsbBroadEn_07001 pDONR223 100% 73.3% 72% None (many diffs) n/a
9 ccsbBroad304_07001 pLX_304 0% 73.3% 72% V5 (many diffs) n/a
10 TRCN0000479224 GCACGATTCGGCACCAGTAAATTC pLX_317 64.8% 73% 71.5% V5 (many diffs) n/a
11 ccsbBroadEn_02357 pDONR223 100% 70.7% 60.7% None (many diffs) n/a
12 ccsbBroad304_02357 pLX_304 0% 70.7% 60.7% V5 (many diffs) n/a
13 TRCN0000479719 TGCAACAGTCTTCCTTTAACGATA pLX_317 61.3% 70.7% 60.7% V5 (many diffs) n/a
14 ccsbBroadEn_02358 pDONR223 100% 70.2% 64.4% None (many diffs) n/a
15 ccsbBroad304_02358 pLX_304 0% 70.2% 64.4% V5 (many diffs) n/a
16 TRCN0000472750 CCACTTCCGTACTCCCCGCTCGCG pLX_317 74.7% 70.2% 64.4% V5 (many diffs) n/a
17 ccsbBroadEn_07003 pDONR223 100% 66.7% 56.8% None (many diffs) n/a
18 ccsbBroad304_07003 pLX_304 0% 66.7% 56.8% V5 (many diffs) n/a
19 TRCN0000475229 CCACCCTATAATTCAACTACCTAC pLX_317 62.8% 66.7% 56.8% V5 (many diffs) n/a
20 ccsbBroadEn_01604 pDONR223 100% 65.3% 47.9% None (many diffs) n/a
21 ccsbBroad304_01604 pLX_304 0% 65.3% 47.9% V5 (many diffs) n/a
22 TRCN0000467573 GAGGTGCGGTAGTGGCTGTCGGAC pLX_317 86% 65.3% 47.9% V5 (many diffs) n/a
23 ccsbBroadEn_07002 pDONR223 100% 57.9% 45.6% None (many diffs) n/a
24 ccsbBroad304_07002 pLX_304 0% 57.9% 45.6% V5 (many diffs) n/a
25 TRCN0000470951 GTCCCTCCTCTCTTCTGCAACACA pLX_317 67.7% 57.9% 45.6% V5 (many diffs) n/a
Download CSV