Transcript: Human NM_001288730.2

Homo sapiens death associated protein kinase 1 (DAPK1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
DAPK1 (1612)
Length:
5710
CDS:
148..4440

Additional Resources:

NCBI RefSeq record:
NM_001288730.2
NBCI Gene record:
DAPK1 (1612)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273222 CAAGGGTGTTTCGTCGATTAT pLKO_005 1843 CDS 100% 13.200 18.480 N DAPK1 n/a
2 TRCN0000000983 CCACGTCGATACCTTGAAATT pLKO.1 1416 CDS 100% 13.200 18.480 N DAPK1 n/a
3 TRCN0000284935 CCACGTCGATACCTTGAAATT pLKO_005 1416 CDS 100% 13.200 18.480 N DAPK1 n/a
4 TRCN0000284936 TCCGCTGTCAACTACGAATTT pLKO_005 835 CDS 100% 13.200 18.480 N DAPK1 n/a
5 TRCN0000000985 CGACATCCAGAACGCTTATTT pLKO.1 2535 CDS 100% 15.000 12.000 N DAPK1 n/a
6 TRCN0000273148 CGACATCCAGAACGCTTATTT pLKO_005 2535 CDS 100% 15.000 12.000 N DAPK1 n/a
7 TRCN0000194694 CCTTGCTTCTTACTGATAATT pLKO.1 4737 3UTR 100% 15.000 10.500 N DAPK1 n/a
8 TRCN0000000982 CTGTCCTGAGAAGCATGTAAT pLKO.1 5542 3UTR 100% 13.200 9.240 N DAPK1 n/a
9 TRCN0000196294 GACATGAAGGTACTTCGAAAT pLKO.1 2965 CDS 100% 10.800 7.560 N DAPK1 n/a
10 TRCN0000024301 GCTTGATATCACTGTGCCAAA pLKO.1 1076 CDS 100% 4.050 2.835 N Dapk1 n/a
11 TRCN0000322199 GCTTGATATCACTGTGCCAAA pLKO_005 1076 CDS 100% 4.050 2.835 N Dapk1 n/a
12 TRCN0000273223 TACCTTGCTTCTTACTGATAA pLKO_005 4735 3UTR 100% 0.000 0.000 N DAPK1 n/a
13 TRCN0000000984 CGGCACCTCTTACAATTCCAT pLKO.1 4398 CDS 100% 3.000 1.800 N DAPK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00421 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00421 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469687 CCGATACTGTATCGATGCACCAGA pLX_317 9.1% 100% 100% V5 n/a
4 TRCN0000489780 TATTACATAAACCATTCCCATTTG pLX_317 8.6% 99.9% 99.9% V5 (not translated due to prior stop codon) 3150C>T;3597C>T;4037G>A n/a
5 ccsbBroadEn_14609 pDONR223 38.2% 99.3% 15.8% None (many diffs) n/a
6 ccsbBroad304_14609 pLX_304 0% 99.3% 15.8% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000473889 ACCCGTCACCAACAGAGATTCCCG pLX_317 8.2% 99.3% 15.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV