Transcript: Human NM_001355194.2

Homo sapiens zinc finger protein 56 (ZNF56), mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ZNF56 (7608)
Length:
1827
CDS:
1026..1718

Additional Resources:

NCBI RefSeq record:
NM_001355194.2
NBCI Gene record:
ZNF56 (7608)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001355194.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1474 CDS 100% 13.200 6.600 Y Zfp934 n/a
2 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1474 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
3 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1474 CDS 100% 13.200 6.600 Y EG668616 n/a
4 TRCN0000146802 CCTCAAACCTTACTACACATA pLKO.1 852 5UTR 100% 4.950 2.475 Y ZNF714 n/a
5 TRCN0000236731 ACCTTACTACACATAAGATAA pLKO_005 1279 CDS 100% 13.200 6.600 Y ZNF98 n/a
6 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1563 CDS 100% 4.950 2.475 Y ZNF28 n/a
7 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 514 5UTR 100% 4.950 2.475 Y ZNF493 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001355194.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469248 TACCCGCTTGGCTTTAAAAACCAA pLX_317 37.7% 49.3% 34.6% V5 (many diffs) n/a
2 ccsbBroadEn_08635 pDONR223 100% 41.6% 32.8% None (many diffs) n/a
3 ccsbBroad304_08635 pLX_304 0% 41.6% 32.8% V5 (many diffs) n/a
4 ccsbBroadEn_12296 pDONR223 100% 49% 38.6% None (many diffs) n/a
5 TRCN0000478211 CAAATCTCTGTTGACCAGACGGTG pLX_317 19.4% 49% 38.6% V5 (many diffs) n/a
6 ccsbBroadEn_09302 pDONR223 100% 38% 26.6% None (many diffs) n/a
7 ccsbBroad304_09302 pLX_304 0% 38% 26.6% V5 (many diffs) n/a
8 TRCN0000478136 TCTGGATTCCTTTAAAAGGATTTC pLX_317 23% 38% 26.6% V5 (many diffs) n/a
Download CSV