Transcript: Human NM_001366083.1

Homo sapiens putative homeodomain transcription factor 2 (PHTF2), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
PHTF2 (57157)
Length:
1957
CDS:
235..1599

Additional Resources:

NCBI RefSeq record:
NM_001366083.1
NBCI Gene record:
PHTF2 (57157)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366083.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285225 ATAGAAAGTCACACCATTATA pLKO_005 1199 CDS 100% 15.000 10.500 N PHTF2 n/a
2 TRCN0000017180 GCTAAGGAATAAACCAAAGAA pLKO.1 339 CDS 100% 5.625 3.938 N PHTF2 n/a
3 TRCN0000274404 GCTAAGGAATAAACCAAAGAA pLKO_005 339 CDS 100% 5.625 3.938 N PHTF2 n/a
4 TRCN0000017178 GCCAGATTGTTTCCACAAGAA pLKO.1 671 CDS 100% 4.950 3.465 N PHTF2 n/a
5 TRCN0000274462 GCCAGATTGTTTCCACAAGAA pLKO_005 671 CDS 100% 4.950 3.465 N PHTF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366083.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15941 pDONR223 0% 76.4% 73.1% None (many diffs) n/a
2 ccsbBroad304_15941 pLX_304 0% 76.4% 73.1% V5 (many diffs) n/a
3 TRCN0000472805 ATACAAACACTAAGAAAAATGACC pLX_317 21% 76.4% 73.1% V5 (many diffs) n/a
4 ccsbBroadEn_15940 pDONR223 0% 75.7% 72.4% None (many diffs) n/a
5 ccsbBroad304_15940 pLX_304 0% 75.7% 72.4% V5 (many diffs) n/a
6 TRCN0000465978 CCCTACCGTCAGTTCATCCGTGCG pLX_317 32.7% 75.7% 72.4% V5 (many diffs) n/a
7 ccsbBroadEn_15939 pDONR223 0% 69.8% 69.8% None 1_411del n/a
8 ccsbBroad304_15939 pLX_304 0% 69.8% 69.8% V5 1_411del n/a
9 TRCN0000468673 ATTCAATCCGCAACACTGGTATCC pLX_317 48.1% 69.8% 69.8% V5 1_411del n/a
10 ccsbBroadEn_03798 pDONR223 100% 60.4% 60.1% None (many diffs) n/a
11 ccsbBroad304_03798 pLX_304 0% 60.4% 60.1% V5 (many diffs) n/a
12 TRCN0000474694 TTCCGATACCCTGCCCGTAGGATC pLX_317 19.9% 60.4% 60.1% V5 (many diffs) n/a
Download CSV