Transcript: Human NM_001366447.1

Homo sapiens RAB GTPase activating protein 1 like (RABGAP1L), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
RABGAP1L (9910)
Length:
2790
CDS:
172..2508

Additional Resources:

NCBI RefSeq record:
NM_001366447.1
NBCI Gene record:
RABGAP1L (9910)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366447.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308188 ATGGTCAAGAATCGCTCTATA pLKO_005 1853 CDS 100% 13.200 18.480 N RABGAP1L n/a
2 TRCN0000048388 CGAGATATTCATCGTACATTT pLKO.1 1798 CDS 100% 13.200 18.480 N RABGAP1L n/a
3 TRCN0000289641 CGAGATATTCATCGTACATTT pLKO_005 1798 CDS 100% 13.200 18.480 N RABGAP1L n/a
4 TRCN0000296275 ACCGGACCTGCATAGCCATTT pLKO_005 2094 CDS 100% 10.800 15.120 N RABGAP1L n/a
5 TRCN0000048392 CGTAATGAAGTAGAGGCTTTA pLKO.1 496 CDS 100% 10.800 15.120 N RABGAP1L n/a
6 TRCN0000106043 TGTGAAATTAAAGAGGCAGTA pLKO.1 760 CDS 100% 4.050 5.670 N Rabgap1l n/a
7 TRCN0000048390 CCAGCCAAACAAATAAGCCAT pLKO.1 338 CDS 100% 2.640 3.696 N RABGAP1L n/a
8 TRCN0000106044 GAGTGTTATTACTCGAGATAT pLKO.1 1785 CDS 100% 0.000 0.000 N Rabgap1l n/a
9 TRCN0000315587 GAGTGTTATTACTCGAGATAT pLKO_005 1785 CDS 100% 0.000 0.000 N Rabgap1l n/a
10 TRCN0000296306 TCCAATCTATAAGGTGTTATT pLKO_005 642 CDS 100% 13.200 10.560 N RABGAP1L n/a
11 TRCN0000048389 GCCTAAGGATAGAGATAAATT pLKO.1 942 CDS 100% 15.000 10.500 N RABGAP1L n/a
12 TRCN0000305118 TGCCTAAGGATAGAGATAAAT pLKO_005 941 CDS 100% 15.000 10.500 N Rabgap1l n/a
13 TRCN0000308185 TAACTCCAGCTGTTGCATTTA pLKO_005 2510 3UTR 100% 13.200 9.240 N RABGAP1L n/a
14 TRCN0000048391 GCACCAGTATTTCTGGCACTT pLKO.1 1177 CDS 100% 4.050 2.835 N RABGAP1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366447.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11431 pDONR223 100% 73% 66.7% None (many diffs) n/a
2 ccsbBroad304_11431 pLX_304 0% 73% 66.7% V5 (many diffs) n/a
3 TRCN0000478216 ACTTTGCACACAACGTACGGCAGA pLX_317 17.3% 73% 66.7% V5 (many diffs) n/a
4 ccsbBroadEn_15682 pDONR223 0% 7.4% 5.3% None (many diffs) n/a
5 ccsbBroad304_15682 pLX_304 0% 7.4% 5.3% V5 (many diffs) n/a
6 TRCN0000473968 AATATCTGTCGGCCTTAAACCATG pLX_317 100% 7.4% 5.3% V5 (many diffs) n/a
Download CSV