Transcript: Human NM_003441.4

Homo sapiens zinc finger protein 141 (ZNF141), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ZNF141 (7700)
Length:
12601
CDS:
171..1595

Additional Resources:

NCBI RefSeq record:
NM_003441.4
NBCI Gene record:
ZNF141 (7700)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003441.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012928 CCGGTGAATAAACATAAGAAA pLKO.1 1899 3UTR 100% 5.625 7.875 N ZNF141 n/a
2 TRCN0000012932 GATCGGAGTCAACATAAGAAA pLKO.1 1395 CDS 100% 5.625 7.875 N ZNF141 n/a
3 TRCN0000012929 CGGTTCTCACACCTGAATAAA pLKO.1 1554 CDS 100% 15.000 10.500 N ZNF141 n/a
4 TRCN0000418631 AGGGTCCTGAATGAACATAAA pLKO_005 1308 CDS 100% 13.200 9.240 N ZNF141 n/a
5 TRCN0000421715 TCACACTTTGCTAAGCATAAA pLKO_005 888 CDS 100% 13.200 9.240 N ZNF141 n/a
6 TRCN0000012930 GCTCCTGAGTCAACATAAGAA pLKO.1 1478 CDS 100% 5.625 3.938 N ZNF141 n/a
7 TRCN0000428825 CCTAACTCAACATAAGGTAAT pLKO_005 725 CDS 100% 10.800 6.480 N ZNF141 n/a
8 TRCN0000012931 CCCAGCTATGTGTTCTCATTT pLKO.1 392 CDS 100% 13.200 6.600 Y ZNF141 n/a
9 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1087 CDS 100% 13.200 6.600 Y Zfp934 n/a
10 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1087 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
11 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1087 CDS 100% 13.200 6.600 Y EG668616 n/a
12 TRCN0000021908 TCAGGGATGTGGCCATAGAAT pLKO.1 187 CDS 100% 5.625 2.813 Y ZNF765 n/a
13 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 5637 3UTR 100% 4.950 2.475 Y CFLAR n/a
14 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 5637 3UTR 100% 4.950 2.475 Y C19orf31 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 9399 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 5635 3UTR 100% 4.950 2.475 Y ERN2 n/a
17 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 5635 3UTR 100% 4.950 2.475 Y P3H4 n/a
18 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 5635 3UTR 100% 4.950 2.475 Y P3H4 n/a
19 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 9803 3UTR 100% 2.640 1.320 Y LINC01098 n/a
20 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 6094 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
21 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6833 3UTR 100% 5.625 2.813 Y EID2B n/a
22 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5802 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003441.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000478123 AGAAGATGTATCCTCCGGGTTGTT pLX_317 11.6% 99.9% 99.7% V5 897C>N n/a
2 ccsbBroadEn_14883 pDONR223 94% 99.8% 99.5% None 897C>N;1353C>N n/a
3 ccsbBroad304_14883 pLX_304 0% 99.8% 99.5% V5 897C>N;1353C>N n/a
4 ccsbBroadEn_09689 pDONR223 100% 63.2% 54.2% None (many diffs) n/a
5 ccsbBroad304_09689 pLX_304 0% 63.2% 54.2% V5 (many diffs) n/a
6 TRCN0000481244 ACCATTTTCTTCACCAGCCAGTGA pLX_317 14.2% 63.2% 54.2% V5 (many diffs) n/a
7 ccsbBroadEn_13469 pDONR223 100% 18% 14.7% None (many diffs) n/a
8 ccsbBroad304_13469 pLX_304 0% 18% 14.7% V5 (many diffs) n/a
9 TRCN0000469082 CACTTTTCAGCTCGAAATTAAATC pLX_317 100% 18% 14.7% V5 (many diffs) n/a
Download CSV