Transcript: Human NM_004938.4

Homo sapiens death associated protein kinase 1 (DAPK1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
DAPK1 (1612)
Length:
5912
CDS:
350..4642

Additional Resources:

NCBI RefSeq record:
NM_004938.4
NBCI Gene record:
DAPK1 (1612)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146680 TTGGCACGGCTATTACTCTG pXPR_003 TGG 1474 34% 16 0.5464 DAPK1 DAPK1 76518
2 BRDN0001149107 AAGTCAATGATCTTGATCCG pXPR_003 AGG 468 11% 5 0.5043 DAPK1 DAPK1 76520
3 BRDN0001148140 ACAACAACATGGATTGACGT pXPR_003 GGG 2499 58% 22 0.3182 DAPK1 DAPK1 76519
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004938.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273222 CAAGGGTGTTTCGTCGATTAT pLKO_005 2045 CDS 100% 13.200 18.480 N DAPK1 n/a
2 TRCN0000000983 CCACGTCGATACCTTGAAATT pLKO.1 1618 CDS 100% 13.200 18.480 N DAPK1 n/a
3 TRCN0000284935 CCACGTCGATACCTTGAAATT pLKO_005 1618 CDS 100% 13.200 18.480 N DAPK1 n/a
4 TRCN0000284936 TCCGCTGTCAACTACGAATTT pLKO_005 1037 CDS 100% 13.200 18.480 N DAPK1 n/a
5 TRCN0000000985 CGACATCCAGAACGCTTATTT pLKO.1 2737 CDS 100% 15.000 12.000 N DAPK1 n/a
6 TRCN0000273148 CGACATCCAGAACGCTTATTT pLKO_005 2737 CDS 100% 15.000 12.000 N DAPK1 n/a
7 TRCN0000194694 CCTTGCTTCTTACTGATAATT pLKO.1 4939 3UTR 100% 15.000 10.500 N DAPK1 n/a
8 TRCN0000000982 CTGTCCTGAGAAGCATGTAAT pLKO.1 5744 3UTR 100% 13.200 9.240 N DAPK1 n/a
9 TRCN0000196294 GACATGAAGGTACTTCGAAAT pLKO.1 3167 CDS 100% 10.800 7.560 N DAPK1 n/a
10 TRCN0000024301 GCTTGATATCACTGTGCCAAA pLKO.1 1278 CDS 100% 4.050 2.835 N Dapk1 n/a
11 TRCN0000322199 GCTTGATATCACTGTGCCAAA pLKO_005 1278 CDS 100% 4.050 2.835 N Dapk1 n/a
12 TRCN0000273223 TACCTTGCTTCTTACTGATAA pLKO_005 4937 3UTR 100% 0.000 0.000 N DAPK1 n/a
13 TRCN0000000984 CGGCACCTCTTACAATTCCAT pLKO.1 4600 CDS 100% 3.000 1.800 N DAPK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004938.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00421 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00421 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469687 CCGATACTGTATCGATGCACCAGA pLX_317 9.1% 100% 100% V5 n/a
4 TRCN0000489780 TATTACATAAACCATTCCCATTTG pLX_317 8.6% 99.9% 99.9% V5 (not translated due to prior stop codon) 3150C>T;3597C>T;4037G>A n/a
5 ccsbBroadEn_14609 pDONR223 38.2% 99.3% 15.8% None (many diffs) n/a
6 ccsbBroad304_14609 pLX_304 0% 99.3% 15.8% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000473889 ACCCGTCACCAACAGAGATTCCCG pLX_317 8.2% 99.3% 15.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV