Transcript: Human NM_007138.2

Homo sapiens zinc finger protein 90 (ZNF90), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZNF90 (7643)
Length:
3744
CDS:
134..1939

Additional Resources:

NCBI RefSeq record:
NM_007138.2
NBCI Gene record:
ZNF90 (7643)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018185 CCTCGATCCTTTATGTACATA pLKO.1 1023 CDS 100% 5.625 7.875 N ZNF90 n/a
2 TRCN0000018184 CCTTAGTCCTTCGTACACATA pLKO.1 1191 CDS 100% 4.950 6.930 N ZNF90 n/a
3 TRCN0000018183 CGCTCCTCAGTCCTTAGTAAA pLKO.1 1691 CDS 100% 13.200 10.560 N ZNF90 n/a
4 TRCN0000018186 CCTCACTCCTTTATAAACATA pLKO.1 1275 CDS 100% 5.625 3.938 N ZNF90 n/a
5 TRCN0000236731 ACCTTACTACACATAAGATAA pLKO_005 1533 CDS 100% 13.200 6.600 Y ZNF98 n/a
6 TRCN0000428574 CTGAAGAGAAACCCTACAAAT pLKO_005 1056 CDS 100% 13.200 6.600 Y ZNF138 n/a
7 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1140 CDS 100% 13.200 6.600 Y Zfp934 n/a
8 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1140 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
9 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1140 CDS 100% 13.200 6.600 Y EG668616 n/a
10 TRCN0000018187 CCCAGAGCAAAGTATTTCAAT pLKO.1 552 CDS 100% 5.625 2.813 Y ZNF90 n/a
11 TRCN0000146802 CCTCAAACCTTACTACACATA pLKO.1 1527 CDS 100% 4.950 2.475 Y ZNF714 n/a
12 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 229 CDS 100% 4.950 2.475 Y ZNF493 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08635 pDONR223 100% 69.1% 58% None (many diffs) n/a
2 ccsbBroad304_08635 pLX_304 0% 69.1% 58% V5 (many diffs) n/a
3 TRCN0000469248 TACCCGCTTGGCTTTAAAAACCAA pLX_317 37.7% 55.1% 46.2% V5 (many diffs) n/a
4 ccsbBroadEn_09302 pDONR223 100% 66.1% 56.2% None (many diffs) n/a
5 ccsbBroad304_09302 pLX_304 0% 66.1% 56.2% V5 (many diffs) n/a
6 TRCN0000478136 TCTGGATTCCTTTAAAAGGATTTC pLX_317 23% 66.1% 56.2% V5 (many diffs) n/a
7 ccsbBroadEn_05180 pDONR223 100% 13.7% 11.4% None (many diffs) n/a
8 ccsbBroad304_05180 pLX_304 0% 13.7% 11.4% V5 (many diffs) n/a
9 TRCN0000466983 TATCGTATGCAGTGATGCCATGTC pLX_317 100% 13.7% 11.4% V5 (many diffs) n/a
10 ccsbBroadEn_15729 pDONR223 0% 11.8% 9.9% None (many diffs) n/a
11 ccsbBroad304_15729 pLX_304 0% 11.8% 9.9% V5 (many diffs) n/a
12 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 11.8% 9.9% V5 (many diffs) n/a
Download CSV