Transcript: Mouse NM_009446.3

Mus musculus tubulin, alpha 3A (Tuba3a), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tuba3a (22144)
Length:
1552
CDS:
112..1464

Additional Resources:

NCBI RefSeq record:
NM_009446.3
NBCI Gene record:
Tuba3a (22144)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089885 CTGGATTTAAGGTGGGTATTA pLKO.1 1157 CDS 100% 13.200 6.600 Y Tuba3b n/a
2 TRCN0000090804 CGACTCATTCAACACATTCTT pLKO.1 249 CDS 100% 5.625 2.813 Y Tuba3a n/a
3 TRCN0000089886 GCCCTGAATGTGGACTTAACA pLKO.1 850 CDS 100% 5.625 2.813 Y Tuba3b n/a
4 TRCN0000090807 CCCACATACACCAACCTCAAT pLKO.1 775 CDS 100% 4.950 2.475 Y Tuba3a n/a
5 TRCN0000062487 CGCACCATCCAGTTTGTAGAT pLKO.1 1126 CDS 100% 4.950 2.475 Y TUBA3C n/a
6 TRCN0000090806 GCTTTCATGGTGGATAACGAA pLKO.1 712 CDS 100% 3.000 1.500 Y Tuba3a n/a
7 TRCN0000089884 CGACTGGATTTAAGGTGGGTA pLKO.1 1154 CDS 100% 2.640 1.320 Y Tuba3b n/a
8 TRCN0000113809 CTTCCTCATCTTCCACAGCTT pLKO.1 513 CDS 100% 2.640 1.320 Y TUBA3FP n/a
9 TRCN0000178352 GTGGTTCCCAAAGATGTCAAT pLKO.1 1078 CDS 100% 4.950 2.475 Y Tuba1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09386 pDONR223 100% 90.3% 99.7% None (many diffs) n/a
2 ccsbBroad304_09386 pLX_304 0% 90.3% 99.7% V5 (many diffs) n/a
3 TRCN0000465924 GTCATGGAGAAAGTCGGTGACCGG pLX_317 28.5% 90.3% 99.7% V5 (many diffs) n/a
4 ccsbBroadEn_09375 pDONR223 100% 90% 98.8% None (many diffs) n/a
5 ccsbBroad304_09375 pLX_304 0% 90% 98.8% V5 (many diffs) n/a
6 TRCN0000469142 GAGGCCACAGGCCATAAACTAATT pLX_317 29% 90% 98.8% V5 (many diffs) n/a
7 ccsbBroadEn_02413 pDONR223 100% 83.9% 97.1% None (many diffs) n/a
8 ccsbBroad304_02413 pLX_304 0% 83.9% 97.1% V5 (many diffs) n/a
9 TRCN0000466437 GGCACCAGGAAACTAGGGGTGTGT pLX_317 31.7% 83.9% 97.1% V5 (many diffs) n/a
10 ccsbBroadEn_15707 pDONR223 0% 83.8% 97.1% None (many diffs) n/a
11 ccsbBroad304_15707 pLX_304 0% 83.8% 97.1% V5 (many diffs) n/a
12 TRCN0000467476 CACCGTCGAGGCCGCTGTATAAGA pLX_317 31.7% 83.8% 97.1% V5 (many diffs) n/a
13 ccsbBroadEn_15706 pDONR223 0% 83.8% 97.1% None (many diffs) n/a
14 ccsbBroad304_15706 pLX_304 0% 83.8% 97.1% V5 (many diffs) n/a
15 TRCN0000472335 TTCTGAAATAAGACACGCCGGGCA pLX_317 37.9% 83.8% 97.1% V5 (many diffs) n/a
16 ccsbBroadEn_01831 pDONR223 100% 83.7% 97.5% None (many diffs) n/a
17 ccsbBroad304_01831 pLX_304 0% 83.7% 97.5% V5 (many diffs) n/a
18 TRCN0000466264 GACTTCAAATAAATAGCTTCACTC pLX_317 23.8% 83.7% 97.5% V5 (many diffs) n/a
19 ccsbBroadEn_09222 pDONR223 100% 83.1% 96.2% None (many diffs) n/a
20 ccsbBroad304_09222 pLX_304 0% 83.1% 96.2% V5 (many diffs) n/a
21 ccsbBroadEn_07108 pDONR223 100% 83.1% 94.2% None (many diffs) n/a
22 ccsbBroad304_07108 pLX_304 0% 83.1% 94.2% V5 (many diffs) n/a
23 TRCN0000467865 AGTTCGTGAAACATACGCCGGCAG pLX_317 34.6% 83.1% 94.2% V5 (many diffs) n/a
24 ccsbBroadEn_16043 pDONR223 0% 83% 96.2% None (many diffs) n/a
25 ccsbBroad304_16043 pLX_304 0% 83% 96.2% V5 (many diffs) n/a
26 TRCN0000465274 AATTCTCGGGCCTTAAGCACTAAC pLX_317 23.4% 83% 96.2% V5 (many diffs) n/a
27 ccsbBroadEn_16042 pDONR223 0% 82.9% 96.2% None (many diffs) n/a
28 ccsbBroad304_16042 pLX_304 0% 82.9% 96.2% V5 (many diffs) n/a
29 ccsbBroadEn_15708 pDONR223 0% 63.1% 72.5% None (many diffs) n/a
Download CSV