Transcript: Human NM_016542.4

Homo sapiens serine/threonine kinase 26 (STK26), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
STK26 (51765)
Length:
3251
CDS:
217..1467

Additional Resources:

NCBI RefSeq record:
NM_016542.4
NBCI Gene record:
STK26 (51765)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148628 GGATGCATATCGGAGTTAGG pXPR_003 TGG 654 52% 7 0.7367 STK26 STK26 76001
2 BRDN0001149381 TTGTTCTGAGAGCAAGACAT pXPR_003 TGG 448 36% 6 0.697 STK26 STK26 76000
3 BRDN0001149000 CCAAAATGGAGTTCCCACAA pXPR_003 AGG 538 43% 6 0.3096 STK26 STK26 75998
4 BRDN0001146165 TTCACAAAATTAGAGCGCAT pXPR_003 TGG 86 7% 3 -0.7563 STK26 STK26 75999
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016542.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195233 CAACTCATGTTATGGGTTAAA pLKO.1 3041 3UTR 100% 13.200 18.480 N STK26 n/a
2 TRCN0000003193 CCAGATTGCTACCATGCTAAA pLKO.1 573 CDS 100% 10.800 15.120 N STK26 n/a
3 TRCN0000320666 CCAGATTGCTACCATGCTAAA pLKO_005 573 CDS 100% 10.800 15.120 N STK26 n/a
4 TRCN0000003192 CATCATTTCGTCCTACAGCAA pLKO.1 992 CDS 100% 2.640 2.112 N STK26 n/a
5 TRCN0000003191 CCTCTTGGTGTATAGTATTTA pLKO.1 2097 3UTR 100% 15.000 10.500 N STK26 n/a
6 TRCN0000320745 CCTCTTGGTGTATAGTATTTA pLKO_005 2097 3UTR 100% 15.000 10.500 N STK26 n/a
7 TRCN0000350279 TCATTGGGAATTACTGCTATT pLKO_005 826 CDS 100% 10.800 7.560 N STK26 n/a
8 TRCN0000003194 GATCCAAAGAAAGTACAGAAT pLKO.1 1216 CDS 100% 4.950 3.465 N STK26 n/a
9 TRCN0000320742 GATCCAAAGAAAGTACAGAAT pLKO_005 1216 CDS 100% 4.950 3.465 N STK26 n/a
10 TRCN0000196861 GCTCCTGAAGTTATTCAACAG pLKO.1 775 CDS 100% 4.050 2.835 N STK26 n/a
11 TRCN0000003195 CTTAAACAGCAGGACGAGAAT pLKO.1 1306 CDS 100% 4.950 2.970 N STK26 n/a
12 TRCN0000320668 CTTAAACAGCAGGACGAGAAT pLKO_005 1306 CDS 100% 4.950 2.970 N STK26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016542.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489362 TAACTTCACCGACTGAACCTGCCG pLX_317 23.4% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000488583 CCTCGCAATGTAAACGGTGATGAG pLX_317 22.6% 99.9% 99.7% V5 1248_1249insG n/a
3 TRCN0000488375 TTCTCACGTAATATCCGCCAGCGC pLX_317 28.3% 85% 85% V5 (not translated due to prior stop codon) 598_783del n/a
4 ccsbBroadEn_12016 pDONR223 100% 30.9% 27.6% None (many diffs) n/a
5 ccsbBroad304_12016 pLX_304 0% 30.9% 27.6% V5 (many diffs) n/a
6 TRCN0000473372 CTCCGCCTCCTCGTCGTGTAGAGA pLX_317 100% 30.9% 27.6% V5 (many diffs) n/a
7 ccsbBroadEn_15074 pDONR223 0% 30.9% 27.6% None (many diffs) n/a
8 ccsbBroad304_15074 pLX_304 0% 30.9% 27.6% V5 (many diffs) n/a
9 TRCN0000474098 CTGAGGCAGCGTCGGCTATTCGCA pLX_317 90.9% 30.9% 27.6% V5 (many diffs) n/a
Download CSV