Transcript: Human NM_018902.4

Homo sapiens protocadherin alpha 11 (PCDHA11), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
PCDHA11 (56138)
Length:
6848
CDS:
1592..4441

Additional Resources:

NCBI RefSeq record:
NM_018902.4
NBCI Gene record:
PCDHA11 (56138)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018902.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055820 GCCCAATGGAAGACACTTATT pLKO.1 2446 CDS 100% 13.200 18.480 N PCDHA11 n/a
2 TRCN0000437215 ACCGAGACGAAGGAGTCAATG pLKO_005 2394 CDS 100% 10.800 15.120 N PCDHA11 n/a
3 TRCN0000055818 CGGAACTTAATTTGCTGCTAA pLKO.1 2208 CDS 100% 4.950 6.930 N PCDHA11 n/a
4 TRCN0000416409 TTGACCTACAGGCTAAGTAAA pLKO_005 2093 CDS 100% 13.200 10.560 N PCDHA11 n/a
5 TRCN0000412706 ACAAATGGTAAGCAGATTAAA pLKO_005 2141 CDS 100% 15.000 10.500 N PCDHA11 n/a
6 TRCN0000433958 CATACTCCTTAATGTCAATTA pLKO_005 2424 CDS 100% 13.200 9.240 N PCDHA11 n/a
7 TRCN0000055822 GTCTTCCTCTAGGTCTGAATA pLKO.1 3912 CDS 100% 13.200 9.240 N PCDHA11 n/a
8 TRCN0000055821 GCTGCTGATTGCGGAATCTAA pLKO.1 2008 CDS 100% 5.625 3.938 N PCDHA11 n/a
9 TRCN0000055819 CCAGAGTTTGATAAATCAGAA pLKO.1 2309 CDS 100% 4.950 3.465 N PCDHA11 n/a
10 TRCN0000056018 GCCTGAAACATCTGTATTATA pLKO.1 5485 3UTR 100% 15.000 7.500 Y PCDHA8 n/a
11 TRCN0000094754 GCTGCTACAGAAGTGCTTTAA pLKO.1 5457 3UTR 100% 13.200 6.600 Y Pcdha5 n/a
12 TRCN0000053275 CTGGAGGTAAATCTGCAGAAT pLKO.1 1814 CDS 100% 4.950 2.475 Y PCDHA9 n/a
13 TRCN0000094877 ACAAATTCATTATCCCAGGAT pLKO.1 4245 CDS 100% 2.640 1.320 Y Pcdha8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018902.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08630 pDONR223 100% 84.9% 84.2% None (many diffs) n/a
2 ccsbBroad304_08630 pLX_304 0% 84.9% 84.2% V5 (many diffs) n/a
3 TRCN0000476743 TACCCAATACGCTCCCGGGGTTCT pLX_317 16.1% 84.9% 84.2% V5 (many diffs) n/a
4 ccsbBroadEn_10461 pDONR223 100% 81.6% 81% None (many diffs) n/a
5 ccsbBroad304_10461 pLX_304 0% 81.6% 81% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000491834 GGCGCATTCTGATCGATACCCATC pLX_317 13.2% 81.6% 81% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_02234 pDONR223 100% 80.9% 79.4% None (many diffs) n/a
8 ccsbBroad304_02234 pLX_304 0% 80.9% 79.4% V5 (many diffs) n/a
9 TRCN0000476214 CTTCGGTCTAAGTTTTCTGTTTTA pLX_317 12.4% 80.9% 79.4% V5 (many diffs) n/a
10 ccsbBroadEn_03707 pDONR223 100% 59.7% 58.7% None (many diffs) n/a
11 ccsbBroad304_03707 pLX_304 0% 59.7% 58.7% V5 (many diffs) n/a
12 TRCN0000466780 TTAATTAGCTTAAAGCACGGCATA pLX_317 17.1% 59.7% 58.7% V5 (many diffs) n/a
Download CSV