Transcript: Human NM_018922.2

Homo sapiens protocadherin gamma subfamily B, 1 (PCDHGB1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
PCDHGB1 (56104)
Length:
4590
CDS:
1..2784

Additional Resources:

NCBI RefSeq record:
NM_018922.2
NBCI Gene record:
PCDHGB1 (56104)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018922.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413526 TCAGAGCTCTCATCGCTTAAT pLKO_005 603 CDS 100% 13.200 18.480 N PCDHGB1 n/a
2 TRCN0000438791 CTCAACCTGACACCGGAAATG pLKO_005 2290 CDS 100% 10.800 15.120 N PCDHGB1 n/a
3 TRCN0000056520 CGGTAGGATAGATCGAGAGAA pLKO.1 252 CDS 100% 4.950 6.930 N PCDHGB1 n/a
4 TRCN0000432971 GGGTTAGTGCAGAGGATTATT pLKO_005 194 CDS 100% 15.000 10.500 N PCDHGB1 n/a
5 TRCN0000056522 CTAACCAGATTCCAGAGGATT pLKO.1 1046 CDS 100% 4.950 3.465 N PCDHGB1 n/a
6 TRCN0000056518 GCCAGTAATGAAGATCACAAA pLKO.1 2359 CDS 100% 4.950 3.465 N PCDHGB1 n/a
7 TRCN0000056519 CCCAATAAGTACCAGCCTCTT pLKO.1 843 CDS 100% 4.050 2.835 N PCDHGB1 n/a
8 TRCN0000056521 CGAAGGAAAGTCCTGATGGAA pLKO.1 536 CDS 100% 3.000 2.100 N PCDHGB1 n/a
9 TRCN0000415381 GCCCTATTCCTACAATCTATG pLKO_005 2232 CDS 100% 10.800 6.480 N PCDHGB1 n/a
10 TRCN0000053813 CCAGCCATAAACCAATAACTA pLKO.1 3685 3UTR 100% 5.625 2.813 Y PCDHGA2 n/a
11 TRCN0000203363 CCCAAGATCAATGCTCAAGTT pLKO.1 3330 3UTR 100% 4.950 2.475 Y PCDHGA7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018922.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08620 pDONR223 100% 86.7% 86.6% None (many diffs) n/a
2 ccsbBroad304_08620 pLX_304 0% 86.7% 86.6% V5 (many diffs) n/a
3 TRCN0000467355 GCCCTATTTTCGAATCGCCCAAAT pLX_317 12.6% 86.7% 86.6% V5 (many diffs) n/a
4 ccsbBroadEn_01151 pDONR223 100% 14.1% 13.4% None (many diffs) n/a
5 ccsbBroad304_01151 pLX_304 0% 14.1% 13.4% V5 (many diffs) n/a
6 TRCN0000466539 CATGGTTCGGTAATGAAAGTTCCA pLX_317 36.4% 14.1% 13.4% V5 (many diffs) n/a
7 ccsbBroadEn_11019 pDONR223 100% 6.4% 6.4% None 1_2601del n/a
8 ccsbBroad304_11019 pLX_304 0% 6.4% 6.4% V5 1_2601del n/a
Download CSV