Transcript: Human NM_138777.5

Homo sapiens mitochondrial ribosome recycling factor (MRRF), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
MRRF (92399)
Length:
9594
CDS:
86..874

Additional Resources:

NCBI RefSeq record:
NM_138777.5
NBCI Gene record:
MRRF (92399)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138777.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045272 GAAGGTTCGCACCAACTCAAT pLKO.1 712 CDS 100% 4.950 6.930 N MRRF n/a
2 TRCN0000290509 GAAGGTTCGCACCAACTCAAT pLKO_005 712 CDS 100% 4.950 6.930 N MRRF n/a
3 TRCN0000045270 GCAATTATCTTGCAGCCTCTA pLKO.1 132 CDS 100% 4.050 3.240 N MRRF n/a
4 TRCN0000290438 GCAATTATCTTGCAGCCTCTA pLKO_005 132 CDS 100% 4.050 3.240 N MRRF n/a
5 TRCN0000045271 GCTGCCTTGGTTGAGGATATA pLKO.1 311 CDS 100% 13.200 9.240 N MRRF n/a
6 TRCN0000290508 GCTGCCTTGGTTGAGGATATA pLKO_005 311 CDS 100% 13.200 9.240 N MRRF n/a
7 TRCN0000248989 TGCAGCTATCAAGGCTATAAG pLKO_005 553 CDS 100% 13.200 9.240 N Mrrf n/a
8 TRCN0000045268 CACTGAAGACAGTGCATGAAA pLKO.1 174 CDS 100% 0.563 0.394 N MRRF n/a
9 TRCN0000290437 CACTGAAGACAGTGCATGAAA pLKO_005 174 CDS 100% 0.563 0.394 N MRRF n/a
10 TRCN0000045269 GCACAGAGAAATGCTGGTGAA pLKO.1 649 CDS 100% 4.050 2.025 Y MRRF n/a
11 TRCN0000290510 GCACAGAGAAATGCTGGTGAA pLKO_005 649 CDS 100% 4.050 2.025 Y MRRF n/a
12 TRCN0000040213 CCTCCCAAATTGCTGGGATTA pLKO.1 4622 3UTR 100% 1.080 0.540 Y IGF1 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6488 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 6283 3UTR 100% 4.950 2.475 Y CCNJL n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6488 3UTR 100% 5.625 2.813 Y EID2B n/a
16 TRCN0000168807 GCTGATCTCAAACTCCTGATA pLKO.1 6442 3UTR 100% 4.950 2.475 Y TMEM105 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138777.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04579 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04579 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474938 TATGTATCACCGACCATACAATCA pLX_317 65.7% 100% 100% V5 n/a
Download CSV