Transcript: Human NR_024241.1

Homo sapiens family with sequence similarity 86 member D, pseudogene (FAM86DP), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
FAM86DP (692099)
Length:
2527
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024241.1
NBCI Gene record:
FAM86DP (692099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024241.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444970 CTGAGCTGCTGCGGGATATTT pLKO_005 233 3UTR 100% 15.000 7.500 Y EEF2KMT n/a
2 TRCN0000447299 TCTGAGCTGCTGCGGGATATT pLKO_005 232 3UTR 100% 13.200 6.600 Y FAM86C1 n/a
3 TRCN0000427069 TTTATATGGGAAAGCGGATAA pLKO_005 1156 3UTR 100% 10.800 5.400 Y FAM86C1 n/a
4 TRCN0000172312 CGAGGGAATGTCCTTCTCAAT pLKO.1 696 3UTR 100% 4.950 2.475 Y EEF2KMT n/a
5 TRCN0000128827 GCTTTCTCTCAGAACTCATCA pLKO.1 319 3UTR 100% 4.950 2.475 Y FAM86B1 n/a
6 TRCN0000129161 GTGCTTTCTCTCAGAACTCAT pLKO.1 317 3UTR 100% 4.950 2.475 Y FAM86B1 n/a
7 TRCN0000130496 GACCAGAAACTGTTTCCCTAT pLKO.1 1035 3UTR 100% 4.050 2.025 Y FAM86B1 n/a
8 TRCN0000172453 CGAACTCTTGCTGCAGAGTTT pLKO.1 32 3UTR 100% 0.495 0.248 Y FAM86C1 n/a
9 TRCN0000168044 CCAACGGGATTGTGAGAATTA pLKO.1 1113 3UTR 100% 13.200 6.600 Y FAM86C1 n/a
10 TRCN0000172901 GCCAGCAGTTCTGGTTCTTAA pLKO.1 1286 3UTR 100% 13.200 6.600 Y EEF2KMT n/a
11 TRCN0000168609 GATGTTGTCATTGCAGCAGAT pLKO.1 828 3UTR 100% 4.050 2.025 Y EEF2KMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024241.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491961 CCGTTCATGATGGCGTAAGTACGC pLX_317 33.3% 39.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488399 TACCTGCGCGCCTAACAATCATGA pLX_317 37.3% 37.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_09791 pDONR223 100% 37.2% None (many diffs) n/a
4 ccsbBroad304_09791 pLX_304 0% 37.2% V5 (many diffs) n/a
5 TRCN0000466174 GGAGAGATGACCTTCCATCATCTG pLX_317 21.3% 37.2% V5 (many diffs) n/a
6 TRCN0000488297 ACTAGACGAAAAATGAGGCATGGA pLX_317 30.4% 37.2% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_03547 pDONR223 100% 14.5% None (many diffs) n/a
8 ccsbBroad304_03547 pLX_304 0% 14.5% V5 (many diffs) n/a
9 TRCN0000473048 AGTGCATTTCATCTCTGTAGCAAC pLX_317 92.4% 14.5% V5 (many diffs) n/a
10 ccsbBroadEn_12901 pDONR223 100% 5.7% None (many diffs) n/a
11 ccsbBroad304_12901 pLX_304 0% 5.7% V5 (many diffs) n/a
12 TRCN0000465314 AGCCAGTACTCTATTCCGAAGGCA pLX_317 100% 5.7% V5 (many diffs) n/a
Download CSV