Transcript: Human NR_027436.2

Homo sapiens FSHD region gene 1 pseudogene (LOC283788), non-coding RNA.

Source:
NCBI, updated 2018-09-23
Taxon:
Homo sapiens (human)
Gene:
LOC283788 (283788)
Length:
3662
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027436.2
NBCI Gene record:
LOC283788 (283788)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027436.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075012 GACATTCCAGAAGAAGACAAA pLKO.1 858 3UTR 100% 4.950 2.475 Y FRG1 n/a
2 TRCN0000168610 GTTGGAATCTGGTGAACAGTA pLKO.1 584 3UTR 100% 4.950 2.475 Y FRG1BP n/a
3 TRCN0000075009 CTGTGCTGAAAGAGAAACCAA pLKO.1 827 3UTR 100% 3.000 1.500 Y FRG1 n/a
4 TRCN0000168842 CCATTGAAATGGATGAGGGAA pLKO.1 636 3UTR 100% 2.640 1.320 Y FRG1BP n/a
5 TRCN0000116227 CCTCCCAAAGTTCTGGGATTA pLKO.1 1660 3UTR 100% 1.080 0.540 Y ELOVL7 n/a
6 TRCN0000164591 CCTCCCAAAGTTCTGGGATTA pLKO.1 1660 3UTR 100% 1.080 0.540 Y TNNI1 n/a
7 TRCN0000377372 TGGCTTTGTTGGCCTCAAATA pLKO_005 721 3UTR 100% 13.200 6.600 Y FRG1 n/a
8 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 1460 3UTR 100% 4.950 2.475 Y CCNJL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027436.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00591 pDONR223 100% 15% None (many diffs) n/a
2 ccsbBroad304_00591 pLX_304 0% 15% V5 (many diffs) n/a
3 TRCN0000471935 TTCCGACCATTCAACCTACGAGGA pLX_317 7.9% 15% V5 (many diffs) n/a
4 ccsbBroadEn_13507 pDONR223 100% 9.5% None (many diffs) n/a
5 ccsbBroad304_13507 pLX_304 0% 9.5% V5 (many diffs) n/a
6 TRCN0000475567 TTCGAAGTGTCGGAGGTTAAGAGA pLX_317 72.9% 9.5% V5 (many diffs) n/a
7 ccsbBroadEn_13536 pDONR223 100% 6.4% None (many diffs) n/a
8 ccsbBroad304_13536 pLX_304 0% 6.4% V5 (many diffs) n/a
9 TRCN0000465837 CATTGACCAAATGTATTGTGCGCG pLX_317 100% 6.4% V5 (many diffs) n/a
Download CSV