Transcript: Human NR_045672.1

Homo sapiens chloride intracellular channel 5 (CLIC5), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-05-20
Taxon:
Homo sapiens (human)
Gene:
CLIC5 (53405)
Length:
5330
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045672.1
NBCI Gene record:
CLIC5 (53405)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_045672.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420853 TCTTAGAAAGAGATCTATTAC pLKO_005 1110 3UTR 100% 13.200 18.480 N CLIC5 n/a
2 TRCN0000044378 CCTAACCAAGGCTCTAAAGAA pLKO.1 345 3UTR 100% 5.625 7.875 N CLIC5 n/a
3 TRCN0000044380 GCCTACGCTGATGTCGCCAAA pLKO.1 643 3UTR 100% 1.350 1.890 N CLIC5 n/a
4 TRCN0000418969 ACTAGCTTCTTCTGCCAATAT pLKO_005 984 3UTR 100% 13.200 10.560 N CLIC5 n/a
5 TRCN0000044382 GCCAAGAAATACCGCAACTAT pLKO.1 520 3UTR 100% 5.625 3.938 N CLIC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045672.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03390 pDONR223 100% 9.4% None (many diffs) n/a
2 ccsbBroad304_03390 pLX_304 0% 9.4% V5 (many diffs) n/a
3 TRCN0000474679 TTTAATTCCTGACGCTCAGATTGC pLX_317 19.6% 9.4% V5 (many diffs) n/a
4 ccsbBroadEn_15858 pDONR223 0% 3.8% None 1_3930del;4138_5330del n/a
5 ccsbBroad304_15858 pLX_304 0% 3.8% V5 1_3930del;4138_5330del n/a
6 TRCN0000478202 TCCGAGAGGTATTAACAAATTGCA pLX_317 100% 3.8% V5 1_3930del;4138_5330del n/a
Download CSV