Transcript: Mouse NM_001039386.1

Mus musculus NMDA receptor synaptonuclear signaling and neuronal migration factor (Nsmf), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Nsmf (56876)
Length:
2949
CDS:
223..1821

Additional Resources:

NCBI RefSeq record:
NM_001039386.1
NBCI Gene record:
Nsmf (56876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306012 CTCGTCTCCAATGGCCGATAT pLKO_005 439 CDS 100% 10.800 15.120 N Nsmf n/a
2 TRCN0000089492 CCGAGTATATCCCTACTATCA pLKO.1 1301 CDS 100% 4.950 6.930 N Nsmf n/a
3 TRCN0000325612 CCGAGTATATCCCTACTATCA pLKO_005 1301 CDS 100% 4.950 6.930 N Nsmf n/a
4 TRCN0000089490 GCCGAATGTCATCCACATCAT pLKO.1 1590 CDS 100% 4.950 6.930 N Nsmf n/a
5 TRCN0000306013 AGATCTGGAAGATGCTGATTT pLKO_005 1436 CDS 100% 13.200 9.240 N Nsmf n/a
6 TRCN0000089489 CCTACTATCATCCGCAGAGAT pLKO.1 1312 CDS 100% 4.950 3.465 N Nsmf n/a
7 TRCN0000165511 GAGAATGATTCCGCGTCTGTA pLKO.1 979 CDS 100% 4.950 3.465 N NSMF n/a
8 TRCN0000089491 GCAGATGATTGAGACCTACTT pLKO.1 1728 CDS 100% 4.950 3.465 N Nsmf n/a
9 TRCN0000325540 GCAGATGATTGAGACCTACTT pLKO_005 1728 CDS 100% 4.950 3.465 N Nsmf n/a
10 TRCN0000089488 CCTGAAACAATTTGAAGGGAA pLKO.1 2159 3UTR 100% 2.640 1.848 N Nsmf n/a
11 TRCN0000306080 CACTCCTGGTGGTCCAGATTA pLKO_005 2009 3UTR 100% 13.200 7.920 N Nsmf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02903 pDONR223 100% 88.9% 93.6% None (many diffs) n/a
2 ccsbBroad304_02903 pLX_304 0% 88.9% 93.6% V5 (many diffs) n/a
3 TRCN0000478064 GAGTCTTCTGTGTTCATACAGTCC pLX_317 2.4% 88.9% 93.6% V5 (many diffs) n/a
4 ccsbBroadEn_02902 pDONR223 100% 84.7% 89.2% None (many diffs) n/a
5 ccsbBroad304_02902 pLX_304 0% 84.7% 89.2% V5 (many diffs) n/a
6 TRCN0000465661 CGCGGCTGACCCGATGTCTGCTGA pLX_317 17% 84.7% 89.2% V5 (many diffs) n/a
Download CSV