Transcript: Mouse NM_179203.3

Mus musculus ATPase family, AAA domain containing 3A (Atad3a), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Atad3a (108888)
Length:
2426
CDS:
96..1871

Additional Resources:

NCBI RefSeq record:
NM_179203.3
NBCI Gene record:
Atad3a (108888)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_179203.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189820 GCGCCTGGTGAGAATGTATTT pLKO.1 1538 CDS 100% 13.200 18.480 N Atad3a n/a
2 TRCN0000242004 GGACTGGCAAGACACTATTTG pLKO_005 1156 CDS 100% 13.200 18.480 N Atad3a n/a
3 TRCN0000242005 TCTGTTGCTGGTCGGTATATT pLKO_005 897 CDS 100% 15.000 12.000 N Atad3a n/a
4 TRCN0000241479 GGTGAAGGATTCCGTGCATTT pLKO_005 792 CDS 100% 10.800 8.640 N Atad3a n/a
5 TRCN0000242003 GGACATTACTCCTACCATATA pLKO_005 2236 3UTR 100% 13.200 9.240 N Atad3a n/a
6 TRCN0000242002 ATTAGCTGTTGGAGTCTATTC pLKO_005 860 CDS 100% 10.800 7.560 N Atad3a n/a
7 TRCN0000190902 CCTCTGTAAGAGGTCAACATT pLKO.1 1955 3UTR 100% 5.625 3.938 N Atad3a n/a
8 TRCN0000135268 CAAGGACAAATGGAGCAACTT pLKO.1 221 CDS 100% 4.950 3.465 N ATAD3A n/a
9 TRCN0000148754 CAAGGACAAATGGAGCAACTT pLKO.1 221 CDS 100% 4.950 3.465 N ATAD3B n/a
10 TRCN0000136856 CCAAGGACAAATGGAGCAACT pLKO.1 220 CDS 100% 4.050 2.835 N ATAD3A n/a
11 TRCN0000201840 GCAGTTTGATTGGGCTATCAA pLKO.1 1463 CDS 100% 0.563 0.338 N Atad3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_179203.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15089 pDONR223 98.8% 82.2% 91% None (many diffs) n/a
2 ccsbBroad304_15089 pLX_304 0% 82.2% 91% V5 (many diffs) n/a
3 TRCN0000469079 GCACCGATTGGCAATGTGGAATAC pLX_317 27.2% 82.2% 91% V5 (many diffs) n/a
4 ccsbBroadEn_09121 pDONR223 100% 75.2% 79.9% None (many diffs) n/a
5 ccsbBroad304_09121 pLX_304 0% 75.2% 79.9% V5 (many diffs) n/a
6 TRCN0000475378 CCGTATGGCCACTCCGAGATAATT pLX_317 20.3% 75.2% 79.9% V5 (many diffs) n/a
Download CSV