Transcript: Human NM_001161576.2

Homo sapiens sterile alpha motif domain containing 4A (SAMD4A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Homo sapiens (human)
Gene:
SAMD4A (23034)
Length:
6575
CDS:
306..2198

Additional Resources:

NCBI RefSeq record:
NM_001161576.2
NBCI Gene record:
SAMD4A (23034)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001161576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308062 TCGACGCGAAAGTAGAATATA pLKO_005 589 CDS 100% 15.000 21.000 N SAMD4A n/a
2 TRCN0000184529 GCAGAAGCTCTTTCGGTCTTT pLKO.1 1688 CDS 100% 4.950 3.960 N Samd4 n/a
3 TRCN0000116143 CCCACCACAATCAATACGATT pLKO.1 981 CDS 100% 4.950 3.465 N SAMD4A n/a
4 TRCN0000116144 GCTCATAGACAAGTGTCTAAT pLKO.1 1610 CDS 100% 1.320 0.924 N SAMD4A n/a
5 TRCN0000308059 AGCCTCCGCCTGCACAAATAT pLKO_005 1041 CDS 100% 15.000 9.000 N SAMD4A n/a
6 TRCN0000116146 GCAACAGGAATCCAAGGATAA pLKO.1 518 CDS 100% 10.800 6.480 N SAMD4A n/a
7 TRCN0000288937 GCAACAGGAATCCAAGGATAA pLKO_005 518 CDS 100% 10.800 6.480 N SAMD4A n/a
8 TRCN0000296041 ACATCCAGCCACTTCGTTAAA pLKO_005 698 CDS 100% 13.200 18.480 N SAMD4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07831 pDONR223 100% 99.7% 99.8% None 1_3delATG;268C>T n/a
2 ccsbBroad304_07831 pLX_304 0% 99.7% 99.8% V5 1_3delATG;268C>T n/a
3 TRCN0000491644 TAACATCATGGATAGATATGTGGT pLX_317 18.5% 99.7% 99.8% V5 1_3delATG;268C>T n/a
4 ccsbBroadEn_15747 pDONR223 0% 46.3% 46.3% None 1_963del;1778_1779ins108 n/a
5 ccsbBroad304_15747 pLX_304 0% 46.3% 46.3% V5 1_963del;1778_1779ins108 n/a
6 TRCN0000465896 TGGTACACAGTCATTTGCATACCT pLX_317 39.4% 46.3% 46.3% V5 1_963del;1778_1779ins108 n/a
7 ccsbBroadEn_11662 pDONR223 100% 38.3% 37.5% None (many diffs) n/a
8 ccsbBroad304_11662 pLX_304 0% 38.3% 37.5% V5 (many diffs) n/a
9 TRCN0000469313 GCGTCCTGTCCTACTGCTGGTGAC pLX_317 65% 38.3% 37.5% V5 (many diffs) n/a
Download CSV