Transcript: Human XM_005273255.2

PREDICTED: Homo sapiens complement component 4 binding protein beta (C4BPB), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C4BPB (725)
Length:
1848
CDS:
218..901

Additional Resources:

NCBI RefSeq record:
XM_005273255.2
NBCI Gene record:
C4BPB (725)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057154 CCAGTGGACAATAGCATATTT pLKO.1 296 CDS 100% 15.000 10.500 N C4BPB n/a
2 TRCN0000057153 CCTGTGAATGTAAGTGACAAA pLKO.1 500 CDS 100% 4.950 3.465 N C4BPB n/a
3 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 682 CDS 100% 0.495 0.248 Y C11orf44 n/a
4 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 919 3UTR 100% 5.625 2.813 Y KLHL30 n/a
5 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 919 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00186 pDONR223 100% 71.1% 57.4% None (many diffs) n/a
2 ccsbBroad304_00186 pLX_304 0% 71.1% 57.4% V5 (many diffs) n/a
3 TRCN0000469754 CAAACCACCATGTCCTCTCACAGA pLX_317 47.6% 71.1% 57.4% V5 (many diffs) n/a
4 ccsbBroadEn_13781 pDONR223 100% 24.8% 11.7% None (many diffs) n/a
5 ccsbBroad304_13781 pLX_304 0% 24.8% 11.7% V5 (many diffs) n/a
6 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 24.8% 11.7% V5 (many diffs) n/a
7 ccsbBroadEn_13787 pDONR223 100% 14.3% 5.5% None (many diffs) n/a
8 ccsbBroad304_13787 pLX_304 0% 14.3% 5.5% V5 (many diffs) n/a
9 TRCN0000472732 ATTTTAATGCCCTACTTTCGGATA pLX_317 100% 14.3% 5.5% V5 (many diffs) n/a
Download CSV