Transcript: Human XM_017027233.1

PREDICTED: Homo sapiens zinc finger protein 221 (ZNF221), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF221 (7638)
Length:
3980
CDS:
299..1978

Additional Resources:

NCBI RefSeq record:
XM_017027233.1
NBCI Gene record:
ZNF221 (7638)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027233.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015269 GAGTGTGGTAAGGACTATAAA pLKO.1 1484 CDS 100% 15.000 10.500 N ZNF221 n/a
2 TRCN0000421456 GTGTTAGATCAAGACTTAATA pLKO_005 1083 CDS 100% 15.000 9.000 N ZNF221 n/a
3 TRCN0000416407 GAAAGCCTTCATTCATGATTC pLKO_005 988 CDS 100% 10.800 6.480 N ZNF221 n/a
4 TRCN0000015271 CTTACCGTTGTAATGAATGTA pLKO.1 630 CDS 100% 5.625 3.375 N ZNF221 n/a
5 TRCN0000416528 TCAGAGTTCACAACTTCATTC pLKO_005 1672 CDS 100% 10.800 5.400 Y ZNF221 n/a
6 TRCN0000015270 AGTAAGTCTATGTGGGAGAAA pLKO.1 1948 CDS 100% 4.950 2.475 Y ZNF221 n/a
7 TRCN0000015268 CCATTCAAATATGAGAACTGT pLKO.1 2054 3UTR 100% 3.000 1.500 Y ZNF221 n/a
8 TRCN0000239543 ACAGGAGAGAAACCTTATAAA pLKO_005 953 CDS 100% 15.000 7.500 Y Gm13212 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2357 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2357 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027233.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07162 pDONR223 100% 90.3% 89.9% None (many diffs) n/a
2 ccsbBroad304_07162 pLX_304 0% 90.3% 89.9% V5 (many diffs) n/a
3 TRCN0000474103 CGTATCCGGTAAACAACTGTACCC pLX_317 13.6% 90.3% 89.9% V5 (many diffs) n/a
4 ccsbBroadEn_07167 pDONR223 100% 71.5% 61.6% None (many diffs) n/a
5 ccsbBroad304_07167 pLX_304 0% 71.5% 61.6% V5 (many diffs) n/a
6 TRCN0000472100 CATTCGAGTACGACGCCCGCGCAT pLX_317 28.8% 71.5% 61.6% V5 (many diffs) n/a
7 ccsbBroadEn_07177 pDONR223 100% 69.4% 61.1% None (many diffs) n/a
8 ccsbBroad304_07177 pLX_304 0% 69.4% 61.1% V5 (many diffs) n/a
9 TRCN0000469087 TAGTTGACACCGCGGTGTCCATGT pLX_317 21.4% 69.4% 61.1% V5 (many diffs) n/a
10 ccsbBroadEn_01821 pDONR223 100% 68.3% 56.8% None (many diffs) n/a
11 ccsbBroad304_01821 pLX_304 0% 68.3% 56.8% V5 (many diffs) n/a
12 TRCN0000468268 AGACCACTGATCAAGATCTATTTA pLX_317 18.1% 68.3% 56.8% V5 (many diffs) n/a
Download CSV