Transcript: Human XM_017011974.1

PREDICTED: Homo sapiens thiamin pyrophosphokinase 1 (TPK1), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TPK1 (27010)
Length:
2429
CDS:
94..825

Additional Resources:

NCBI RefSeq record:
XM_017011974.1
NBCI Gene record:
TPK1 (27010)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038005 CGCTTATATGATATCACCGAA pLKO.1 108 CDS 100% 2.640 3.696 N TPK1 n/a
2 TRCN0000038006 GACTTTACTAAGTGCCTTAAA pLKO.1 391 CDS 100% 13.200 10.560 N TPK1 n/a
3 TRCN0000197025 GCAGTCATAGGGCTGATAATA pLKO.1 1860 3UTR 100% 15.000 10.500 N TPK1 n/a
4 TRCN0000195020 CAAGAATCATTGACCTAATTG pLKO.1 1378 3UTR 100% 13.200 9.240 N TPK1 n/a
5 TRCN0000219786 GTACTGCCTTGTAATTCTTAA pLKO.1 11 5UTR 100% 13.200 9.240 N TPK1 n/a
6 TRCN0000219787 GTGATTGGTGTGGCCTTATTC pLKO.1 632 CDS 100% 13.200 9.240 N TPK1 n/a
7 TRCN0000038007 CAGAGAATACTATGCTACTAA pLKO.1 252 CDS 100% 5.625 3.938 N TPK1 n/a
8 TRCN0000195506 CAAGAGGAATCGCTGATCTAC pLKO.1 562 CDS 100% 4.950 3.465 N TPK1 n/a
9 TRCN0000038008 CATTGGTCAGTACTTCCAATA pLKO.1 731 CDS 100% 1.080 0.756 N TPK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489639 ATTGATGTCTGGGAAGTCTCCCAC pLX_317 56.9% 68.5% 64.3% V5 (not translated due to prior stop codon) 0_1ins136;50_107del;178_255del n/a
2 ccsbBroadEn_11838 pDONR223 100% 68.3% 64% None (many diffs) n/a
3 ccsbBroad304_11838 pLX_304 0% 68.3% 64% V5 (many diffs) n/a
4 TRCN0000470689 CAACATTATCCATTCCACCATCGT pLX_317 56.2% 68.3% 64% V5 (many diffs) n/a
5 ccsbBroadEn_15039 pDONR223 0% 68.3% 64% None (many diffs) n/a
6 ccsbBroad304_15039 pLX_304 0% 68.3% 64% V5 (many diffs) n/a
7 TRCN0000480139 CATTGGTCGATGTTTAGTACGTCG pLX_317 57% 68.3% 64% V5 (many diffs) n/a
8 TRCN0000491741 TACGCAACGCCATGAATTACAAAA pLX_317 83.7% 56.1% 56.1% V5 (not translated due to prior stop codon) 1_318del;729_730insTTG n/a
9 ccsbBroadEn_14113 pDONR223 100% 55.8% 2.4% None 1_318del;332_334delAGAinsG;343A>G n/a
10 ccsbBroad304_14113 pLX_304 0% 55.8% 2.4% V5 (not translated due to prior stop codon) 1_318del;332_334delAGAinsG;343A>G n/a
11 TRCN0000471369 ATATTAAGTTAGTCCCACAAACCT pLX_317 100% 55.8% 2.4% V5 (not translated due to prior stop codon) 1_318del;332_334delAGAinsG;343A>G n/a
Download CSV