Transcript: Human XM_017023223.1

PREDICTED: Homo sapiens kinesin family member C3 (KIFC3), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIFC3 (3801)
Length:
3250
CDS:
16..2583

Additional Resources:

NCBI RefSeq record:
XM_017023223.1
NBCI Gene record:
KIFC3 (3801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023223.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271532 ACGACATCAACAAGGTGTTTG pLKO_005 1940 CDS 100% 10.800 15.120 N KIFC3 n/a
2 TRCN0000116466 CAACGACTACAATGGGCTCAA pLKO.1 1218 CDS 100% 4.050 5.670 N KIFC3 n/a
3 TRCN0000116462 TGCAAATTGCATGGGCGGAAA pLKO.1 2756 3UTR 100% 4.050 5.670 N KIFC3 n/a
4 TRCN0000271531 AGCGCTGCGGAGATCTACAAT pLKO_005 1798 CDS 100% 5.625 4.500 N KIFC3 n/a
5 TRCN0000271533 ACCTGAAGGAGAAGCTCATTA pLKO_005 404 CDS 100% 13.200 9.240 N KIFC3 n/a
6 TRCN0000271534 TGAAGGCTGTGCACGAGAATC pLKO_005 1142 CDS 100% 10.800 7.560 N KIFC3 n/a
7 TRCN0000116463 CTGCGTAAGAAGTGCCACAAT pLKO.1 1372 CDS 100% 4.950 3.465 N KIFC3 n/a
8 TRCN0000116465 GACGCTCTATTCCCTCAAGTT pLKO.1 2343 CDS 100% 4.950 3.465 N KIFC3 n/a
9 TRCN0000271541 TTCAGAAGGAAACGGTGTCTC pLKO_005 2718 3UTR 100% 4.050 2.835 N KIFC3 n/a
10 TRCN0000116464 TCTTGCATTGATGGCTTCAAT pLKO.1 1624 CDS 100% 0.563 0.394 N KIFC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023223.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488029 AACGCATGTCCGTGTACATCGGTC pLX_317 14.8% 80.2% 80.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14686 pDONR223 97% 80.1% 80% None (many diffs) n/a
3 ccsbBroad304_14686 pLX_304 0% 80.1% 80% V5 (many diffs) n/a
4 TRCN0000481469 CGTTTGCCGTTTGTCCTGATCTTA pLX_317 25.8% 77.3% 77.3% V5 (many diffs) n/a
Download CSV