Transcript: Human NR_144392.1

Homo sapiens exportin 5 (XPO5), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
XPO5 (57510)
Length:
5502
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144392.1
NBCI Gene record:
XPO5 (57510)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_144392.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429397 ATGTTTGTACAGCGCTATTAA pLKO_005 3417 3UTR 100% 15.000 21.000 N XPO5 n/a
2 TRCN0000158915 CCAGATGTTTCGAACACTAAA pLKO.1 1756 3UTR 100% 13.200 18.480 N XPO5 n/a
3 TRCN0000420169 GACAATTTGCTTGCGCTTATA pLKO_005 2669 3UTR 100% 13.200 18.480 N XPO5 n/a
4 TRCN0000163976 CCGAGAAGTCATGGACCTAAT pLKO.1 3247 3UTR 100% 10.800 15.120 N XPO5 n/a
5 TRCN0000164164 CGTTGTCAAGTTTCGGTGGAA pLKO.1 430 3UTR 100% 2.640 3.696 N XPO5 n/a
6 TRCN0000424783 GATGTTGCCATGCATTATATA pLKO_005 1088 3UTR 100% 15.000 10.500 N XPO5 n/a
7 TRCN0000162741 CCTGGAGATAAGAGCTGTAAT pLKO.1 3673 3UTR 100% 13.200 9.240 N XPO5 n/a
8 TRCN0000425106 ACCAATTCAAACGCCTCATTG pLKO_005 3792 3UTR 100% 10.800 7.560 N XPO5 n/a
9 TRCN0000159130 GATACTGTGTTTGCTGTTGAA pLKO.1 967 3UTR 100% 4.950 3.465 N XPO5 n/a
10 TRCN0000159427 GCAGAGTTAATCCATACAGAA pLKO.1 5036 3UTR 100% 4.950 3.465 N XPO5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144392.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489026 TGCGCGCTGGAATAGGGCGCAATC pLX_317 9.5% 65.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_12356 pDONR223 100% 36.4% None 1_1819del;2372_2509del;3962_5502del n/a
3 ccsbBroad304_12356 pLX_304 0% 36.4% V5 1_1819del;2372_2509del;3962_5502del n/a
4 TRCN0000467370 CTCACTTAAACACATATTGAACCT pLX_317 17.1% 36.4% V5 1_1819del;2372_2509del;3962_5502del n/a
5 ccsbBroadEn_12355 pDONR223 100% 15.2% None 1_3121del;3962_5502del n/a
6 ccsbBroad304_12355 pLX_304 0% 15.2% V5 1_3121del;3962_5502del n/a
7 TRCN0000479170 TCAAGCACCTGCGTTGCCCATAGT pLX_317 54.8% 15.2% V5 1_3121del;3962_5502del n/a
Download CSV