Transcript: Human NM_173537.4

Homo sapiens GTF2I repeat domain containing 2 (GTF2IRD2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GTF2IRD2 (84163)
Length:
3583
CDS:
216..3065

Additional Resources:

NCBI RefSeq record:
NM_173537.4
NBCI Gene record:
GTF2IRD2 (84163)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173537.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020992 CCCTGAAATTGGCTTCCAGAA pLKO.1 2638 CDS 100% 4.050 2.430 N GTF2IRD2 n/a
2 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 3297 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
3 TRCN0000435626 TCGATGAGATCACGGATATAA pLKO_005 1867 CDS 100% 15.000 7.500 Y GTF2IRD2 n/a
4 TRCN0000020993 CCTGTACTACACGGAGATTAA pLKO.1 2330 CDS 100% 13.200 6.600 Y GTF2IRD2 n/a
5 TRCN0000020989 GCAAGCATTATGACCAGTATA pLKO.1 1627 CDS 100% 13.200 6.600 Y GTF2IRD2 n/a
6 TRCN0000157406 GCCCTCGAATCCATGTGTAAA pLKO.1 300 CDS 100% 13.200 6.600 Y GTF2IRD2B n/a
7 TRCN0000151243 GCAGGGATTTCATTCATCATA pLKO.1 732 CDS 100% 5.625 2.813 Y GTF2IRD2B n/a
8 TRCN0000151754 CGCAAAGATTCTTTCCATGTT pLKO.1 2930 CDS 100% 4.950 2.475 Y GTF2IRD2B n/a
9 TRCN0000155187 GAGATGAGGTTTCACCATGTT pLKO.1 3329 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
10 TRCN0000157407 GATCTCGGCTTACTGCAACTT pLKO.1 3211 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
11 TRCN0000154764 GCGTATTTCTTCGTGGAAGTA pLKO.1 1518 CDS 100% 4.950 2.475 Y GTF2IRD2B n/a
12 TRCN0000020990 GCTGTCTGATTTCAAACTCTA pLKO.1 2723 CDS 100% 4.950 2.475 Y GTF2IRD2 n/a
13 TRCN0000155454 GCGCAAAGATTCTTTCCATGT pLKO.1 2929 CDS 100% 4.050 2.025 Y GTF2IRD2B n/a
14 TRCN0000157719 CCTGAGAATTACGACCTTGCA pLKO.1 684 CDS 100% 2.640 1.320 Y GTF2IRD2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173537.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14494 pDONR223 100% 99.5% 98.8% None (many diffs) n/a
2 ccsbBroad304_14494 pLX_304 0% 99.5% 98.8% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000475879 CAAGAACGGTTTTTTCTGCCATGC pLX_317 12.2% 99.5% 98.8% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_12786 pDONR223 100% 49.3% 44.1% None (many diffs) n/a
5 ccsbBroad304_12786 pLX_304 0% 49.3% 44.1% V5 (many diffs) n/a
6 TRCN0000465352 GATGGCAATATAAGTGATGTTCTC pLX_317 21.4% 49.3% 44.1% V5 (many diffs) n/a
7 ccsbBroadEn_12785 pDONR223 100% 25.5% 24.1% None (many diffs) n/a
8 ccsbBroad304_12785 pLX_304 0% 25.5% 24.1% V5 (many diffs) n/a
9 TRCN0000469667 CGATCACCGATGTAAGTTTATTTC pLX_317 48.6% 25.5% 24.1% V5 (many diffs) n/a
Download CSV