Transcript: Human NM_001012753.2

Homo sapiens zinc finger protein 763 (ZNF763), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ZNF763 (284390)
Length:
2871
CDS:
170..1363

Additional Resources:

NCBI RefSeq record:
NM_001012753.2
NBCI Gene record:
ZNF763 (284390)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001012753.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155191 GCTGTCCATTGTCTCAGATTA pLKO.1 800 CDS 100% 13.200 9.240 N ZNF763 n/a
2 TRCN0000155405 CCCACGTCATTTCAAAGACAT pLKO.1 1747 3UTR 100% 4.950 3.465 N ZNF763 n/a
3 TRCN0000154525 GCATTCCATAGTTCCAGTTCT pLKO.1 968 CDS 100% 4.950 3.465 N ZNF763 n/a
4 TRCN0000157019 GCCATGTGGTAAAGCCTTCAA pLKO.1 1454 3UTR 100% 4.950 2.970 N ZNF763 n/a
5 TRCN0000156732 GCTGGATATTTCGCAGAGGAA pLKO.1 238 CDS 100% 2.640 1.584 N ZNF763 n/a
6 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1428 3UTR 100% 15.000 7.500 Y ZNF443 n/a
7 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1428 3UTR 100% 15.000 7.500 Y Zfp97 n/a
8 TRCN0000016370 CCTCCTTTAGAACACAAGAAA pLKO.1 648 CDS 100% 5.625 2.813 Y ZNF440 n/a
9 TRCN0000149143 GAGAAACTTCAGGAGTCTCAT pLKO.1 358 CDS 100% 4.950 2.475 Y ZNF69 n/a
10 TRCN0000154837 GAAGACAGTCATTGTGGAGAA pLKO.1 404 CDS 100% 4.050 2.025 Y ZNF763 n/a
11 TRCN0000149677 GATGCTGGAAACTTTCAGGAA pLKO.1 274 CDS 100% 2.640 1.320 Y ZNF69 n/a
12 TRCN0000156989 GCTGGAAACTTTCAGGAACCT pLKO.1 277 CDS 100% 2.640 1.320 Y ZNF763 n/a
13 TRCN0000226240 GAGAAGCCCTACGAGTGTAAT pLKO_005 1954 3UTR 100% 13.200 6.600 Y LOC676710 n/a
14 TRCN0000434057 GAGAAGCCCTACGAGTGTAAC pLKO_005 1954 3UTR 100% 10.800 5.400 Y Zfp647 n/a
15 TRCN0000107953 GCTGTGAACTTCACCCAGGAA pLKO.1 206 CDS 100% 2.640 1.320 Y ZNF799 n/a
16 TRCN0000427014 ACCGGAGAGAAACCCTATGAG pLKO_005 677 CDS 100% 4.950 2.475 Y Zfp647 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012753.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000471005 ACATCAGGGGTCAATTGTCCTCTC pLX_317 27.5% 75.2% 66.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_15236 pDONR223 77.6% 58.4% 50.3% None (many diffs) n/a
3 ccsbBroad304_15236 pLX_304 0% 58.4% 50.3% V5 (many diffs) n/a
4 TRCN0000479573 TCAACGTGAACCTTCGTTCCTCGT pLX_317 53.6% 50% 39.2% V5 (not translated due to frame shift) (many diffs) n/a
5 ccsbBroadEn_15207 pDONR223 64.2% 48.2% 42.2% None (many diffs) n/a
6 ccsbBroad304_15207 pLX_304 0% 48.2% 42.2% V5 (many diffs) n/a
7 ccsbBroadEn_01804 pDONR223 100% 32.2% 29.8% None (many diffs) n/a
8 ccsbBroad304_01804 pLX_304 0% 32.2% 29.8% V5 (many diffs) n/a
Download CSV