Transcript: Human XM_011509392.2

PREDICTED: Homo sapiens dual serine/threonine and tyrosine protein kinase (DSTYK), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DSTYK (25778)
Length:
7846
CDS:
23..2785

Additional Resources:

NCBI RefSeq record:
XM_011509392.2
NBCI Gene record:
DSTYK (25778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509392.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275831 TAATCAGGCAGTGGCTAATAA pLKO_005 1411 CDS 100% 15.000 21.000 N DSTYK n/a
2 TRCN0000195393 CCGCTTTATCGCCAGCTAATT pLKO.1 899 CDS 100% 13.200 18.480 N DSTYK n/a
3 TRCN0000275823 GTTGAATGACTGAGCATATTC pLKO_005 2954 3UTR 100% 13.200 18.480 N DSTYK n/a
4 TRCN0000275833 ATTCCGGACTCGGCTCAATAG pLKO_005 1759 CDS 100% 10.800 15.120 N DSTYK n/a
5 TRCN0000196529 GAGGACTAGATGATTCTACTT pLKO.1 2763 CDS 100% 4.950 3.960 N DSTYK n/a
6 TRCN0000037512 GCTACTAACATGGAGTTTAAA pLKO.1 1298 CDS 100% 15.000 10.500 N DSTYK n/a
7 TRCN0000382296 AGCGAAAGATCACCGCTTTAT pLKO_005 887 CDS 100% 13.200 9.240 N DSTYK n/a
8 TRCN0000382377 CACAGGGAAGTACGATAATTC pLKO_005 2458 CDS 100% 13.200 9.240 N DSTYK n/a
9 TRCN0000194775 CATGAAAGAATGACCCTTATT pLKO.1 6031 3UTR 100% 13.200 9.240 N DSTYK n/a
10 TRCN0000195331 CCAACCCAATGCGAAGTATTT pLKO.1 3997 3UTR 100% 13.200 9.240 N DSTYK n/a
11 TRCN0000196387 GCTTTGGAATTTCACTATATG pLKO.1 2078 CDS 100% 13.200 9.240 N DSTYK n/a
12 TRCN0000275776 GCTTTGGAATTTCACTATATG pLKO_005 2078 CDS 100% 13.200 9.240 N DSTYK n/a
13 TRCN0000037513 CCAGAACGTCTTCCTGTGTTT pLKO.1 2606 CDS 100% 4.950 3.465 N DSTYK n/a
14 TRCN0000037509 CGTGCCAAGATCACTGACTTA pLKO.1 2363 CDS 100% 4.950 3.465 N DSTYK n/a
15 TRCN0000037510 CGGAGATAATAGACTCCTCAA pLKO.1 852 CDS 100% 4.050 2.835 N DSTYK n/a
16 TRCN0000037511 GCACTGGAATGATCTGGCTTT pLKO.1 2062 CDS 100% 4.050 2.835 N DSTYK n/a
17 TRCN0000275830 GGGACTTGTCCATCGTGATAT pLKO_005 2308 CDS 100% 13.200 7.920 N DSTYK n/a
18 TRCN0000088496 GCAAAGACCATCTCTGGAATA pLKO.1 2565 CDS 100% 10.800 7.560 N Dstyk n/a
19 TRCN0000288040 GCAAAGACCATCTCTGGAATA pLKO_005 2565 CDS 100% 10.800 7.560 N Dstyk n/a
20 TRCN0000088495 CCTGTGATAACCTATGCACTT pLKO.1 731 CDS 100% 4.050 2.835 N Dstyk n/a
21 TRCN0000288104 CCTGTGATAACCTATGCACTT pLKO_005 731 CDS 100% 4.050 2.835 N Dstyk n/a
22 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 3658 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509392.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15025 pDONR223 95.5% 98.7% 98.6% None (many diffs) n/a
2 ccsbBroadEn_15768 pDONR223 0% 94.1% 94% None 625_626ins27;1894T>C;2440_2574del n/a
3 ccsbBroad304_15768 pLX_304 0% 94.1% 94% V5 625_626ins27;1894T>C;2440_2574del n/a
4 ccsbBroadEn_15026 pDONR223 0% 94.1% 94% None 625_626ins27;1894T>C;2440_2574del n/a
5 ccsbBroad304_15026 pLX_304 0% 94.1% 94% V5 625_626ins27;1894T>C;2440_2574del n/a
6 TRCN0000474096 CAAAGCTTAGATGTAGCCTTTTTC pLX_317 17.6% 94.1% 94% V5 625_626ins27;1894T>C;2440_2574del n/a
7 TRCN0000491323 AAGTAGCCCTTGGGAAGAAAGCCG pLX_317 15.4% 94.1% 94% V5 (not translated due to prior stop codon) 625_626ins27;1894T>C;2440_2574del n/a
Download CSV