Transcript: Human XM_011531229.3

PREDICTED: Homo sapiens cancer/testis antigen family 45 member A7 (CT45A7), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CT45A7 (101060211)
Length:
910
CDS:
130..699

Additional Resources:

NCBI RefSeq record:
XM_011531229.3
NBCI Gene record:
CT45A7 (101060211)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531229.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265769 ACGAGAAATTAATGCTGATAT pLKO_005 486 CDS 100% 13.200 6.600 Y CT45A1 n/a
2 TRCN0000256387 ACTTGTCCCTGGAGGATTATC pLKO_005 704 3UTR 100% 13.200 6.600 Y CT45A1 n/a
3 TRCN0000256386 AGAAACTGAAACGTATGATTT pLKO_005 677 CDS 100% 13.200 6.600 Y CT45A1 n/a
4 TRCN0000262282 TACTTGTCCCTGGAGGATTAT pLKO_005 703 3UTR 100% 13.200 6.600 Y CT45A6 n/a
5 TRCN0000256385 TAGATCCTGAAACTGTGTTTA pLKO_005 158 CDS 100% 13.200 6.600 Y CT45A1 n/a
6 TRCN0000256388 ACTGCAGTCAGGAAGCGATTT pLKO_005 592 CDS 100% 10.800 5.400 Y CT45A1 n/a
7 TRCN0000160286 CCAAATGCATAATCTCGTTAA pLKO.1 730 3UTR 100% 10.800 5.400 Y CT45A3 n/a
8 TRCN0000262283 CTTATGACAGGACATGCTATT pLKO_005 301 CDS 100% 10.800 5.400 Y CT45A6 n/a
9 TRCN0000282166 GAAACTGAAACGTATGATTTG pLKO_005 678 CDS 100% 10.800 5.400 Y CT45A6 n/a
10 TRCN0000140518 GCTCTGCCATGTCCAAAGAAA pLKO.1 275 CDS 100% 5.625 2.813 Y CT45A3 n/a
11 TRCN0000165952 GCTCTGCCATGTCCAAAGAAA pLKO.1 275 CDS 100% 5.625 2.813 Y CT45A5 n/a
12 TRCN0000159327 GTATGAGACGAGACTTTGTTA pLKO.1 644 CDS 100% 5.625 2.813 Y CT45A5 n/a
13 TRCN0000159388 GTTAAGCACCTTAAGAAGAAA pLKO.1 661 CDS 100% 5.625 2.813 Y CT45A3 n/a
14 TRCN0000159478 CACCTTAAGAAGAAACTGAAA pLKO.1 667 CDS 100% 4.950 2.475 Y CT45A3 n/a
15 TRCN0000180265 CAGCAGTTTCTCTGGAGATGA pLKO.1 426 CDS 100% 4.950 2.475 Y CT45A1 n/a
16 TRCN0000146574 CCCAAATGCATAATCTCGTTA pLKO.1 729 3UTR 100% 4.950 2.475 Y CT45A2 n/a
17 TRCN0000158603 CCCAAATGCATAATCTCGTTA pLKO.1 729 3UTR 100% 4.950 2.475 Y CT45A3 n/a
18 TRCN0000161521 GAATGTGACAGTCCTTCGTAT pLKO.1 190 CDS 100% 4.950 2.475 Y CT45A3 n/a
19 TRCN0000145123 GAGACTTTGTTAAGCACCTTA pLKO.1 653 CDS 100% 4.950 2.475 Y CT45A3 n/a
20 TRCN0000159931 GAGACTTTGTTAAGCACCTTA pLKO.1 653 CDS 100% 4.950 2.475 Y CT45A3 n/a
21 TRCN0000141709 GATGACCTAGAATGCAGAGAA pLKO.1 442 CDS 100% 4.950 2.475 Y CT45A3 n/a
22 TRCN0000149167 GATGACCTAGAATGCAGAGAA pLKO.1 442 CDS 100% 4.950 2.475 Y CT45A2 n/a
23 TRCN0000160930 GATGACCTAGAATGCAGAGAA pLKO.1 442 CDS 100% 4.950 2.475 Y CT45A3 n/a
24 TRCN0000144845 GATTGATGACTTCACTGGTTT pLKO.1 345 CDS 100% 4.950 2.475 Y CT45A3 n/a
25 TRCN0000147521 GATTGATGACTTCACTGGTTT pLKO.1 345 CDS 100% 4.950 2.475 Y CT45A2 n/a
26 TRCN0000158798 GATTGATGACTTCACTGGTTT pLKO.1 345 CDS 100% 4.950 2.475 Y CT45A5 n/a
27 TRCN0000145563 GCACCTTAAGAAGAAACTGAA pLKO.1 666 CDS 100% 4.950 2.475 Y CT45A3 n/a
28 TRCN0000159125 GCACCTTAAGAAGAAACTGAA pLKO.1 666 CDS 100% 4.950 2.475 Y CT45A5 n/a
29 TRCN0000142159 GCTTATGACAGGACATGCTAT pLKO.1 300 CDS 100% 4.950 2.475 Y CT45A3 n/a
30 TRCN0000149651 GCTTATGACAGGACATGCTAT pLKO.1 300 CDS 100% 4.950 2.475 Y CT45A2 n/a
31 TRCN0000161519 GCTTATGACAGGACATGCTAT pLKO.1 300 CDS 100% 4.950 2.475 Y CT45A5 n/a
32 TRCN0000150185 GTAGATCCTGAAACTGTGTTT pLKO.1 157 CDS 100% 4.950 2.475 Y CT45A2 n/a
33 TRCN0000159311 GTAGATCCTGAAACTGTGTTT pLKO.1 157 CDS 100% 4.950 2.475 Y CT45A3 n/a
34 TRCN0000140428 GAGGAAACGTTACCAGCAGTT pLKO.1 413 CDS 100% 4.050 2.025 Y CT45A3 n/a
35 TRCN0000164916 GAGGAAACGTTACCAGCAGTT pLKO.1 413 CDS 100% 4.050 2.025 Y CT45A3 n/a
36 TRCN0000166079 GATGCAGAAACCTGGTAGCAA pLKO.1 381 CDS 100% 3.000 1.500 Y CT45A5 n/a
37 TRCN0000180183 CCAGCCAATTGGATTCTCAGA pLKO.1 326 CDS 100% 2.640 1.320 Y CT45A1 n/a
38 TRCN0000140311 CCATCATCAAGGAAGCAGCAA pLKO.1 620 CDS 100% 2.640 1.320 Y CT45A3 n/a
39 TRCN0000166598 CCATCATCAAGGAAGCAGCAA pLKO.1 620 CDS 100% 2.640 1.320 Y CT45A5 n/a
40 TRCN0000142598 GAAATGCTTGAAGGAGTGCAA pLKO.1 565 CDS 100% 2.640 1.320 Y CT45A3 n/a
41 TRCN0000149280 GAAATGCTTGAAGGAGTGCAA pLKO.1 565 CDS 100% 2.640 1.320 Y CT45A2 n/a
42 TRCN0000161235 GAAATGCTTGAAGGAGTGCAA pLKO.1 565 CDS 100% 2.640 1.320 Y CT45A5 n/a
43 TRCN0000140625 GAATACTTGTCCCTGGAGGAT pLKO.1 700 CDS 100% 2.640 1.320 Y CT45A3 n/a
44 TRCN0000165597 GAATACTTGTCCCTGGAGGAT pLKO.1 700 CDS 100% 2.640 1.320 Y CT45A5 n/a
45 TRCN0000139919 GCAGCAAGATGTATGAGACGA pLKO.1 634 CDS 100% 2.640 1.320 Y CT45A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531229.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05681 pDONR223 100% 99.8% 99.4% None 247G>A n/a
2 ccsbBroad304_05681 pLX_304 0% 99.8% 99.4% V5 247G>A n/a
3 TRCN0000467507 AGGGTCTATCAGCTTTCCTGCATG pLX_317 73.4% 99.8% 99.4% V5 247G>A n/a
4 ccsbBroadEn_05682 pDONR223 100% 97.8% 94.7% None (many diffs) n/a
5 ccsbBroad304_05682 pLX_304 0% 97.8% 94.7% V5 (many diffs) n/a
6 TRCN0000474647 TATCGTAATACATCCCGTTGCTTT pLX_317 73.4% 97.8% 94.7% V5 (many diffs) n/a
Download CSV