Transcript: Human XM_011544519.2

PREDICTED: Homo sapiens inhibitor of nuclear factor kappa B kinase subunit beta (IKBKB), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IKBKB (3551)
Length:
3380
CDS:
232..2472

Additional Resources:

NCBI RefSeq record:
XM_011544519.2
NBCI Gene record:
IKBKB (3551)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544519.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381300 GTATTTCAGACGGCAAGTTAA pLKO_005 1163 CDS 100% 13.200 18.480 N IKBKB n/a
2 TRCN0000018919 CCATGATGAATCTCCTCCGAA pLKO.1 1415 CDS 100% 2.640 3.696 N IKBKB n/a
3 TRCN0000380934 ACAGCGAGCAAACCGAGTTTG pLKO_005 1544 CDS 100% 10.800 7.560 N IKBKB n/a
4 TRCN0000380993 ATCATCCATCGGGATCTAAAG pLKO_005 475 CDS 100% 10.800 7.560 N IKBKB n/a
5 TRCN0000381893 CATGAATGCCTCTCGACTTAG pLKO_005 2079 CDS 100% 10.800 7.560 N IKBKB n/a
6 TRCN0000380744 GGCAGTCTTTGCACATCATTC pLKO_005 580 CDS 100% 10.800 7.560 N IKBKB n/a
7 TRCN0000018916 CCAGCCAAGAAGAGTGAAGAA pLKO.1 2155 CDS 100% 4.950 3.465 N IKBKB n/a
8 TRCN0000329736 CCAGCCAAGAAGAGTGAAGAA pLKO_005 2155 CDS 100% 4.950 3.465 N IKBKB n/a
9 TRCN0000018918 CGGAAGTACCTGAACCAGTTT pLKO.1 367 CDS 100% 4.950 3.465 N IKBKB n/a
10 TRCN0000353621 CGGAAGTACCTGAACCAGTTT pLKO_005 367 CDS 100% 4.950 3.465 N IKBKB n/a
11 TRCN0000018917 GCTGGTTCATATCTTGAACAT pLKO.1 984 CDS 100% 0.495 0.347 N IKBKB n/a
12 TRCN0000329735 GCTGGTTCATATCTTGAACAT pLKO_005 984 CDS 100% 0.495 0.347 N IKBKB n/a
13 TRCN0000353566 CAAGGAGAACAGAGGTTAATA pLKO_005 517 CDS 100% 15.000 9.000 N IKBKB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544519.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489474 CATCAGAGCTTCTTGCTCATCAGT pLX_317 17.5% 85.2% 82% V5 (many diffs) n/a
2 TRCN0000487969 TCACTCTGCATCGTATCCGTTGCT pLX_317 13.6% 85.2% 82% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_00841 pDONR223 100% 42% 39.6% None (many diffs) n/a
4 ccsbBroad304_00841 pLX_304 53.3% 42% 39.6% V5 (many diffs) n/a
5 TRCN0000477990 GGTACCTCTGAAAACAACGAACAT pLX_317 32.8% 42% 39.6% V5 (many diffs) n/a
6 ccsbBroadEn_11616 pDONR223 100% 3% 2.5% None (many diffs) n/a
7 ccsbBroad304_11616 pLX_304 0% 3% 2.5% V5 (many diffs) n/a
8 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 3% 2.5% V5 (many diffs) n/a
Download CSV