Transcript: Human XM_017012093.2

PREDICTED: Homo sapiens glucuronidase beta (GUSB), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GUSB (2990)
Length:
2040
CDS:
697..1827

Additional Resources:

NCBI RefSeq record:
XM_017012093.2
NBCI Gene record:
GUSB (2990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012093.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029292 GCCCTGCCTATCTGTATTCAT pLKO.1 911 CDS 100% 5.625 3.938 N GUSB n/a
2 TRCN0000343994 GCCCTGCCTATCTGTATTCAT pLKO_005 911 CDS 100% 5.625 3.938 N GUSB n/a
3 TRCN0000029289 CCGAATCACTATCGCCATCAA pLKO.1 509 5UTR 100% 4.950 3.465 N GUSB n/a
4 TRCN0000343993 CCGAATCACTATCGCCATCAA pLKO_005 509 5UTR 100% 4.950 3.465 N GUSB n/a
5 TRCN0000029293 CTGGTATAAGAAGTATCAGAA pLKO.1 1452 CDS 100% 4.950 3.465 N GUSB n/a
6 TRCN0000343995 CTGGTATAAGAAGTATCAGAA pLKO_005 1452 CDS 100% 4.950 3.465 N GUSB n/a
7 TRCN0000029290 GCAGAAACGATTGCAGGGTTT pLKO.1 1498 CDS 100% 4.050 2.835 N GUSB n/a
8 TRCN0000344062 GCAGAAACGATTGCAGGGTTT pLKO_005 1498 CDS 100% 4.050 2.835 N GUSB n/a
9 TRCN0000029291 GCCAAGTCACAATGTTTGGAA pLKO.1 1789 CDS 100% 3.000 2.100 N GUSB n/a
10 TRCN0000343996 GCCAAGTCACAATGTTTGGAA pLKO_005 1789 CDS 100% 3.000 2.100 N GUSB n/a
11 TRCN0000062038 CAAGGGTTACTTTGTCCAGAA pLKO.1 599 5UTR 100% 4.050 2.025 Y GUSBP11 n/a
12 TRCN0000142395 GAACAGCTACTACTCTTGGTA pLKO.1 1374 CDS 100% 3.000 1.500 Y GUSBP15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012093.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00710 pDONR223 100% 56.7% 55.9% None 0_1ins685;38_50del;240_241ins153 n/a
2 ccsbBroad304_00710 pLX_304 0% 56.7% 55.9% V5 0_1ins685;38_50del;240_241ins153 n/a
3 TRCN0000481467 GCCCAGACCTGGCCCATATGTCAG pLX_317 28.2% 56.7% 55.9% V5 0_1ins685;38_50del;240_241ins153 n/a
4 ccsbBroadEn_10363 pDONR223 100% 31.4% 16.4% None (many diffs) n/a
5 ccsbBroad304_10363 pLX_304 0% 31.4% 16.4% V5 (many diffs) n/a
6 TRCN0000468935 ACAAATCCACAGGGATACGTAGGA pLX_317 82.2% 31.4% 16.4% V5 (many diffs) n/a
7 TRCN0000480097 CCTACCAATTATGTCCTACTGCCC pLX_317 90.5% 31.4% 16.4% V5 (many diffs) n/a
8 TRCN0000465895 CCTGACATAGAGGTGGGACTACAG pLX_317 77.6% 31.4% 16.4% V5 (many diffs) n/a
9 ccsbBroadEn_14986 pDONR223 97.2% 31.3% 16.3% None (many diffs) n/a
10 ccsbBroad304_14986 pLX_304 0% 31.3% 16.3% V5 (many diffs) n/a
11 ccsbBroadEn_13733 pDONR223 100% 22.6% 16.2% None (many diffs) n/a
12 ccsbBroad304_13733 pLX_304 0% 22.6% 16.2% V5 (many diffs) n/a
13 TRCN0000466397 GCGGGGGCGTGTGCCAGAGAATTC pLX_317 100% 22.6% 16.2% V5 (many diffs) n/a
14 ccsbBroadEn_13642 pDONR223 100% 22.5% 16.4% None (many diffs) n/a
15 ccsbBroad304_13642 pLX_304 0% 22.5% 16.4% V5 (many diffs) n/a
16 TRCN0000466500 GCTTTGTGTAGGTATACCCTTCGC pLX_317 100% 22.5% 16.4% V5 (many diffs) n/a
17 ccsbBroadEn_10410 pDONR223 100% 21.2% 15.3% None (many diffs) n/a
18 ccsbBroad304_10410 pLX_304 0% 21.2% 15.3% V5 (many diffs) n/a
19 TRCN0000468931 TTGATACAAGTTGGTTCCTGGCAG pLX_317 100% 21.2% 15.3% V5 (many diffs) n/a
Download CSV