Vector: pLKO_005

View vector index

Vector Information:

Vector Name:
pLKO_005
Alias:
pLKO.5, pLKO_TRC005
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
1.9 KB Stuffer
Selection Marker:
PuroR
Visible Reporter:
n/a
Cloning Site:
1.9 KB Stuffer

Sequence Data Files

For a free vector file viewer, try ApE or SnapGene Viewer.

GenBank[?] FASTA SnapGene[?] Revision Notes
1 GB FASTA DNA 2017-04-12: Sequence corrected; changes unlikely to have functional consequences
2 GB FASTA n/a (original version)
Download CSV

Control Clones

Clone ID Target Seq Target Gene ID Target Gene Symbol Taxon Target Region Notes Addgene[?]
1 TRCN0000231755 GCGACGTAAACGGCCACAAGT GFP GFP CONTROL CDS
n/a
2 TRCN0000231750 CAACAGCCACAACGTCTATAT GFP GFP CONTROL CDS
n/a
3 TRCN0000231757 CTACGGCAAGCTGACCCTGAA GFP GFP CONTROL CDS
n/a
4 TRCN0000231745 TGACCCTGAAGTTCATCTGCA GFP GFP CONTROL CDS
n/a
5 TRCN0000231765 CCTACGGCGTGCAGTGCTTCA GFP GFP CONTROL CDS
n/a
6 TRCN0000231749 CGACCACATGAAGCAGCACGA GFP GFP CONTROL CDS
n/a
7 TRCN0000231759 GACCACATGAAGCAGCACGAC GFP GFP CONTROL CDS
n/a
8 TRCN0000231762 CCACATGAAGCAGCACGACTT GFP GFP CONTROL CDS
n/a
9 TRCN0000231744 AGTACAACTACAACAGCCACA GFP GFP CONTROL CDS
n/a
10 TRCN0000231747 TACAACAGCCACAACGTCTAT GFP GFP CONTROL CDS
n/a
11 TRCN0000231753 ACAACAGCCACAACGTCTATA GFP GFP CONTROL CDS
n/a
12 TRCN0000231756 ACGTCTATATCATGGCCGACA GFP GFP CONTROL CDS
n/a
13 TRCN0000231754 CTATATCATGGCCGACAAGCA GFP GFP CONTROL CDS
n/a
14 TRCN0000231760 GAACGGCATCAAGGTGAACTT GFP GFP CONTROL CDS
n/a
15 TRCN0000231705 GCCACAACATCGAGGACGGCA GFP GFP CONTROL CDS
n/a
16 TRCN0000231746 TGCCCGACAACCACTACCTGA GFP GFP CONTROL CDS
n/a
17 TRCN0000231758 GCGCGATCACATGGTCCTGCT GFP GFP CONTROL CDS
n/a
18 TRCN0000231748 CGGGATCACTCTCGGCATGGA GFP GFP CONTROL CDS
n/a
19 TRCN0000231764 CTCTCGGCATGGACGAGCTGT GFP GFP CONTROL CDS
n/a
20 TRCN0000231761 CGACGTAAACGGCCACAAGTT GFP GFP CONTROL CDS
n/a
21 TRCN0000231763 CCCGACCACATGAAGCAGCAC GFP GFP CONTROL CDS
n/a
22 TRCN0000231751 CGGCATGGACGAGCTGTACAA GFP GFP CONTROL CDS
n/a
23 TRCN0000231752 TCTCGGCATGGACGAGCTGTA GFP GFP CONTROL CDS
n/a
24 TRCN0000231740 TGAGTACTTCGAAATGTCCGT LUCIFERASE LUCIFERASE CONTROL CDS
n/a
25 TRCN0000231736 CACTTACGCTGAGTACTTCGA LUCIFERASE LUCIFERASE CONTROL CDS
n/a
26 TRCN0000231693 CTTCGAAATGTCCGTTCGGTT LUCIFERASE LUCIFERASE CONTROL CDS
n/a
27 TRCN0000231699 CAAATCACAGAATCGTCGTAT LUCIFERASE LUCIFERASE CONTROL CDS
n/a
28 TRCN0000231695 ATCACAGAATCGTCGTATGCA LUCIFERASE LUCIFERASE CONTROL CDS
n/a
29 TRCN0000231697 TCACAGAATCGTCGTATGCAG LUCIFERASE LUCIFERASE CONTROL CDS
n/a
30 TRCN0000231730 AGAATCGTCGTATGCAGTGAA LUCIFERASE LUCIFERASE CONTROL CDS
n/a
31 TRCN0000231720 GAATCGTCGTATGCAGTGAAA LUCIFERASE LUCIFERASE CONTROL CDS
n/a
32 TRCN0000231737 ATGTTTACTACACTCGGATAT LUCIFERASE LUCIFERASE CONTROL CDS
n/a
33 TRCN0000231732 ACACTCGGATATTTGATATGT LUCIFERASE LUCIFERASE CONTROL CDS
n/a
34 TRCN0000231707 CACTCGGATATTTGATATGTG LUCIFERASE LUCIFERASE CONTROL CDS
n/a
35 TRCN0000231719 GCGGTTGCCAAGAGGTTCCAT LUCIFERASE LUCIFERASE CONTROL CDS
n/a
36 TRCN0000231721 TGTCCGGTTATGTAAACAATC LUCIFERASE LUCIFERASE CONTROL CDS
n/a
37 TRCN0000231718 AGTCAAGTAACAACCGCGAAA LUCIFERASE LUCIFERASE CONTROL CDS
n/a
38 TRCN0000231727 GTTGTGTTTGTGGACGAAGTA LUCIFERASE LUCIFERASE CONTROL CDS
n/a
39 TRCN0000231731 GCGCCATTCTATCCGCTGGAA LUCIFERASE LUCIFERASE CONTROL CDS
n/a
40 TRCN0000231715 CGCTGAGTACTTCGAAATGTC LUCIFERASE LUCIFERASE CONTROL CDS
n/a
41 TRCN0000231739 AGTACTTCGAAATGTCCGTTC LUCIFERASE LUCIFERASE CONTROL CDS
n/a
42 TRCN0000231714 CAGAATCGTCGTATGCAGTGA LUCIFERASE LUCIFERASE CONTROL CDS
n/a
43 TRCN0000231729 GAATGTTTACTACACTCGGAT LUCIFERASE LUCIFERASE CONTROL CDS
n/a
44 TRCN0000231734 TCTACTGGTCTGCCTAAAGGT LUCIFERASE LUCIFERASE CONTROL CDS
n/a
45 TRCN0000231741 GCTGAGTACTTCGAAATGTCC LUCIFERASE LUCIFERASE CONTROL CDS
n/a
46 TRCN0000231742 ACGCTGAGTACTTCGAAATGT LUCIFERASE LUCIFERASE CONTROL CDS
n/a
47 TRCN0000231733 ACTTACGCTGAGTACTTCGAA LUCIFERASE LUCIFERASE CONTROL CDS
n/a
48 TRCN0000231728 GAGTACTTCGAAATGTCCGTT LUCIFERASE LUCIFERASE CONTROL CDS
n/a
49 TRCN0000231703 GCTCCGTGAACGGCCACGAGT RFP RFP CONTROL CDS
n/a
50 TRCN0000231691 GAACGGCCACGAGTTCGAGAT RFP RFP CONTROL CDS
n/a
51 TRCN0000231698 CGAGTTCGAGATCGAGGGCGA RFP RFP CONTROL CDS
n/a
52 TRCN0000231683 CTCAGTTCCAGTACGGCTCCA RFP RFP CONTROL CDS
n/a
53 TRCN0000231686 CAGTTCCAGTACGGCTCCAAG RFP RFP CONTROL CDS
n/a
54 TRCN0000231684 GTACGGCTCCAAGGCCTACGT RFP RFP CONTROL CDS
n/a
55 TRCN0000231682 GCTTCAAGTGGGAGCGCGTGA RFP RFP CONTROL CDS
n/a
56 TRCN0000231688 CCTGCAGGACGGCGAGTTCAT RFP RFP CONTROL CDS
n/a
57 TRCN0000231724 CCGTAATGCAGAAGAAGACCA RFP RFP CONTROL CDS
n/a
58 TRCN0000231690 CGTAATGCAGAAGAAGACCAT RFP RFP CONTROL CDS
n/a
59 TRCN0000231696 GTAATGCAGAAGAAGACCATG RFP RFP CONTROL CDS
n/a
60 TRCN0000231687 TGCAGAAGAAGACCATGGGCT RFP RFP CONTROL CDS
n/a
61 TRCN0000231689 CTACAAGACCGACATCAAGCT RFP RFP CONTROL CDS
n/a
62 TRCN0000231692 CAACGAGGACTACACCATCGT RFP RFP CONTROL CDS
n/a
63 TRCN0000231725 ACTACACCATCGTGGAACAGT RFP RFP CONTROL CDS
n/a
64 TRCN0000231723 CTACACCATCGTGGAACAGTA RFP RFP CONTROL CDS
n/a
65 TRCN0000231701 TCAGTTCCAGTACGGCTCCAA RFP RFP CONTROL CDS
n/a
66 TRCN0000231694 CCACTACGACGCCGAGGTCAA RFP RFP CONTROL CDS
n/a
67 TRCN0000231700 GCCGTCGTATTACAACGTCGT lacZ lacZ CONTROL CDS
n/a
68 TRCN0000231717 CGTCGTATTACAACGTCGTGA lacZ lacZ CONTROL CDS
n/a
69 TRCN0000231702 TCGTATTACAACGTCGTGACT lacZ lacZ CONTROL CDS
n/a
70 TRCN0000231735 CCAACGTGACCTATCCCATTA lacZ lacZ CONTROL CDS
n/a
71 TRCN0000231716 CGACCACGCAAATCAGCGATT lacZ lacZ CONTROL CDS
n/a
72 TRCN0000231743 CGCGCCTTTCGGCGGTGAAAT lacZ lacZ CONTROL CDS
n/a
73 TRCN0000231726 TGTTCGCATTATCCGAACCAT lacZ lacZ CONTROL CDS
n/a
74 TRCN0000231722 CGCGATCGTAATCACCCGAGT lacZ lacZ CONTROL CDS
n/a
75 TRCN0000231712 GCGATCGTAATCACCCGAGTG lacZ lacZ CONTROL CDS
n/a
76 TRCN0000231709 CGATCGTAATCACCCGAGTGT lacZ lacZ CONTROL CDS
n/a
77 TRCN0000231708 GCGCTAATCACGACGCGCTGT lacZ lacZ CONTROL CDS
n/a
78 TRCN0000231710 CGCTAAATACTGGCAGGCGTT lacZ lacZ CONTROL CDS
n/a
79 TRCN0000231706 GTCGGCTTACGGCGGTGATTT lacZ lacZ CONTROL CDS
n/a
80 TRCN0000231685 GTTCCGTCATAGCGATAACGA lacZ lacZ CONTROL CDS
n/a
81 TRCN0000231738 CCGTCATAGCGATAACGAGTT lacZ lacZ CONTROL CDS
n/a
82 TRCN0000231713 ACTCTGGCTAACGGTACGCGT lacZ lacZ CONTROL CDS
n/a
83 TRCN0000231704 GCGTTGGCAATTTAACCGCCA lacZ lacZ CONTROL CDS
n/a
84 TRCN0000231711 CCCGTCAGTATCGGCGGAATT lacZ lacZ CONTROL CDS
n/a
85 TRCN0000241923 (no hairpin) n/a n/a n/a
n/a
Download CSV