Transcript: Human NM_001161500.1

Homo sapiens zinc finger protein 611 (ZNF611), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
ZNF611 (81856)
Length:
4417
CDS:
176..2293

Additional Resources:

NCBI RefSeq record:
NM_001161500.1
NBCI Gene record:
ZNF611 (81856)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001161500.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018182 ACTAGAATTGACTGTGGAGAA pLKO.1 1592 CDS 100% 4.050 5.670 N ZNF611 n/a
2 TRCN0000018179 CTAATGATGCTCCCTCAGTTT pLKO.1 726 CDS 100% 4.950 3.960 N ZNF611 n/a
3 TRCN0000423357 TCAGAGATCGTTCACATATTG pLKO_005 2652 3UTR 100% 13.200 9.240 N ZNF611 n/a
4 TRCN0000018180 TGCGTAATTCACTCCTGTCAA pLKO.1 2154 CDS 100% 4.950 3.465 N ZNF611 n/a
5 TRCN0000018178 GAGACACATAAGATAGGTCAT pLKO.1 1751 CDS 100% 4.050 2.835 N ZNF611 n/a
6 TRCN0000018181 CCCTTCTAATTGATAAGGCAA pLKO.1 1161 CDS 100% 2.640 1.848 N ZNF611 n/a
7 TRCN0000413712 GACAAGACTTGGGAGTGATTC pLKO_005 2392 3UTR 100% 10.800 6.480 N ZNF611 n/a
8 TRCN0000018107 GCTGGAAACAAGCCTATTAAA pLKO.1 614 CDS 100% 15.000 7.500 Y ZNF600 n/a
9 TRCN0000015887 GTGAAGAATGTGACAAAGTTT pLKO.1 1290 CDS 100% 5.625 2.813 Y ZNF702P n/a
10 TRCN0000142662 GCAAGGCAATACAGAAGTGAT pLKO.1 409 CDS 100% 4.950 2.475 Y ZNF468 n/a
11 TRCN0000142023 GTAAGGTTTGTGACAAGGCTT pLKO.1 1542 CDS 100% 2.640 1.320 Y ZNF468 n/a
12 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1274 CDS 100% 4.950 2.475 Y ZNF28 n/a
13 TRCN0000148611 CGTAGACTTCATACTGGAGAA pLKO.1 1091 CDS 100% 4.050 2.025 Y ZNF761 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161500.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08581 pDONR223 100% 56.7% 49.2% None (many diffs) n/a
2 ccsbBroad304_08581 pLX_304 0% 56.7% 49.2% V5 (many diffs) n/a
3 TRCN0000476486 AGTATTTAAATCGATGTCTATAAC pLX_317 30.4% 56.7% 49.2% V5 (many diffs) n/a
4 ccsbBroadEn_05629 pDONR223 100% 20.6% 16.8% None (many diffs) n/a
5 ccsbBroad304_05629 pLX_304 0% 20.6% 16.8% V5 (many diffs) n/a
6 TRCN0000468214 TCTCTAGTACCTCAATAGGTGGTT pLX_317 94.7% 20.6% 16.8% V5 (many diffs) n/a
7 ccsbBroadEn_13667 pDONR223 100% 4.5% 2.6% None (many diffs) n/a
8 ccsbBroad304_13667 pLX_304 0% 4.5% 2.6% V5 (many diffs) n/a
9 TRCN0000471939 ATACCCTTCTTATTCAGAGCAATT pLX_317 100% 4.5% 2.6% V5 (many diffs) n/a
Download CSV