Transcript: Human NM_001199893.2

Homo sapiens actin gamma 2, smooth muscle (ACTG2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ACTG2 (72)
Length:
1372
CDS:
81..1082

Additional Resources:

NCBI RefSeq record:
NM_001199893.2
NBCI Gene record:
ACTG2 (72)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199893.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116597 CCGTAAGGACTTATATGCCAA pLKO.1 821 CDS 100% 2.640 3.696 N ACTG2 n/a
2 TRCN0000440776 CTCACAGAGAGAGGCTATTCC pLKO_005 531 CDS 100% 4.950 3.465 N ACTG2 n/a
3 TRCN0000116599 GAGAGAAATTGTGCGAGACAT pLKO.1 569 CDS 100% 4.950 3.465 N ACTG2 n/a
4 TRCN0000427747 TGGATCAGCAAGCCTGAGTAT pLKO_005 1020 CDS 100% 4.950 3.465 N ACTG2 n/a
5 TRCN0000116600 GCAGGTTATCACCATTGGCAA pLKO.1 689 CDS 100% 2.640 1.848 N ACTG2 n/a
6 TRCN0000116601 CGACAGGCATCGTCCTGGATT pLKO.1 397 CDS 100% 1.650 1.155 N ACTG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199893.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05765 pDONR223 100% 88.2% None (many diffs) n/a
2 ccsbBroad304_05765 pLX_304 0% 88.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479785 GTCCCCTGGATCAGGACGGTAAAA pLX_317 31.6% 88.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_00015 pDONR223 100% 76.6% 87.2% None (many diffs) n/a
5 ccsbBroad304_00015 pLX_304 0% 76.6% 87.2% V5 (many diffs) n/a
6 TRCN0000468012 TCTATATTCTTCCCTCACTCATAA pLX_317 37.9% 76.6% 87.2% V5 (many diffs) n/a
7 ccsbBroadEn_00014 pDONR223 100% 75.2% 87.7% None (many diffs) n/a
8 ccsbBroad304_00014 pLX_304 0% 75.2% 87.7% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000467679 GCTACTGCTTTGAGGGTTATAACT pLX_317 37.9% 75.2% 87.7% V5 (not translated due to prior stop codon) (many diffs) n/a
10 ccsbBroadEn_05763 pDONR223 100% 74.5% 81.6% None (many diffs) n/a
11 ccsbBroad304_05763 pLX_304 53.1% 74.5% 81.6% V5 (many diffs) n/a
12 TRCN0000470279 TCAAGCCTGGAACGGGCTCACGTC pLX_317 31.7% 74.5% 81.6% V5 (many diffs) n/a
13 ccsbBroadEn_05764 pDONR223 100% 72.9% 82.7% None (many diffs) n/a
14 ccsbBroad304_05764 pLX_304 0% 72.9% 82.7% V5 (many diffs) n/a
15 TRCN0000466781 AATTGTGGTGCTTGTTGCCGCCTG pLX_317 31.7% 72.9% 82.7% V5 (many diffs) n/a
16 ccsbBroadEn_15351 pDONR223 0% 72.8% 82.7% None (many diffs) n/a
17 ccsbBroad304_15351 pLX_304 0% 72.8% 82.7% V5 (many diffs) n/a
18 ccsbBroadEn_13808 pDONR223 100% 72.8% 82.1% None (many diffs) n/a
19 ccsbBroad304_13808 pLX_304 0% 72.8% 82.1% V5 (not translated due to frame shift) (many diffs) n/a
20 TRCN0000471742 AATGGGAGTTCTCACGTCAGGTCC pLX_317 44.8% 72.8% 82.1% V5 (not translated due to frame shift) (many diffs) n/a
21 ccsbBroadEn_05497 pDONR223 100% 71.4% 77.3% None (many diffs) n/a
22 ccsbBroad304_05497 pLX_304 0% 71.4% 77.3% V5 (many diffs) n/a
23 TRCN0000480996 TCGCGGAGACTCACCCAATCCCGC pLX_317 35.4% 71.4% 77.3% V5 (many diffs) n/a
Download CSV