Transcript: Human NM_001267716.2

Homo sapiens zinc finger protein 728 (ZNF728), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
ZNF728 (388523)
Length:
2600
CDS:
147..2015

Additional Resources:

NCBI RefSeq record:
NM_001267716.2
NBCI Gene record:
ZNF728 (388523)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001267716.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 982 CDS 100% 13.200 6.600 Y Zfp934 n/a
2 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 982 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
3 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 982 CDS 100% 13.200 6.600 Y EG668616 n/a
4 TRCN0000107875 CACTTGATTGTAGGTAAGATA pLKO.1 2465 3UTR 100% 5.625 2.813 Y ZNF254 n/a
5 TRCN0000017702 CCCTGGAATATGAAGAGACAT pLKO.1 330 CDS 100% 4.950 2.475 Y ZNF430 n/a
6 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 242 CDS 100% 4.950 2.475 Y ZNF493 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267716.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09784 pDONR223 100% 70.1% 58.6% None (many diffs) n/a
2 ccsbBroad304_09784 pLX_304 0% 70.1% 58.6% V5 (many diffs) n/a
3 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 70.1% 58.6% V5 (many diffs) n/a
4 ccsbBroadEn_15167 pDONR223 53.6% 69.8% 28.7% None (many diffs) n/a
5 ccsbBroad304_15167 pLX_304 0% 69.8% 28.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_10024 pDONR223 100% 69.1% 58.6% None (many diffs) n/a
7 ccsbBroad304_10024 pLX_304 0% 69.1% 58.6% V5 (many diffs) n/a
8 TRCN0000466950 AAAAATGGGCGCTCTGAGACACAC pLX_317 21.1% 69.1% 58.6% V5 (many diffs) n/a
9 ccsbBroadEn_15273 pDONR223 50.9% 65.8% 56.4% None (many diffs) n/a
10 ccsbBroad304_15273 pLX_304 0% 65.8% 56.4% V5 (many diffs) n/a
11 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 29.7% 24.7% V5 (not translated due to frame shift) (many diffs) n/a
12 ccsbBroadEn_07157 pDONR223 100% 65.3% 55.5% None (many diffs) n/a
13 ccsbBroad304_07157 pLX_304 0% 65.3% 55.5% V5 (many diffs) n/a
14 TRCN0000475452 TAAAACTTCAACTTGGTTTCCTTC pLX_317 10.2% 65.3% 55.5% V5 (many diffs) n/a
15 ccsbBroadEn_15729 pDONR223 0% 11.7% 9.9% None (many diffs) n/a
16 ccsbBroad304_15729 pLX_304 0% 11.7% 9.9% V5 (many diffs) n/a
17 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 11.7% 9.9% V5 (many diffs) n/a
18 ccsbBroadEn_11384 pDONR223 100% 11.4% 10.1% None (many diffs) n/a
19 ccsbBroad304_11384 pLX_304 0% 11.4% 10.1% V5 (many diffs) n/a
20 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 11.4% 10.1% V5 (many diffs) n/a
21 ccsbBroadEn_13746 pDONR223 100% 11% 10.4% None (many diffs) n/a
22 ccsbBroad304_13746 pLX_304 0% 11% 10.4% V5 (many diffs) n/a
23 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 11% 10.4% V5 (many diffs) n/a
Download CSV