Transcript: Human NM_001289951.2

Homo sapiens zinc finger protein 761 (ZNF761), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ZNF761 (388561)
Length:
3983
CDS:
230..2470

Additional Resources:

NCBI RefSeq record:
NM_001289951.2
NBCI Gene record:
ZNF761 (388561)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289951.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021905 GACGTGATGCTGGAGAATTAT pLKO.1 332 CDS 100% 15.000 7.500 Y ZNF765 n/a
2 TRCN0000021906 CCCTGCTCAGAGGACTCTATA pLKO.1 307 CDS 100% 13.200 6.600 Y ZNF765 n/a
3 TRCN0000021815 CCGGAGAGAAACCTTACAAAT pLKO.1 2115 CDS 100% 13.200 6.600 Y ZNF253 n/a
4 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1359 CDS 100% 13.200 6.600 Y Zfp934 n/a
5 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1359 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
6 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1359 CDS 100% 13.200 6.600 Y EG668616 n/a
7 TRCN0000183437 GCTTACAGTTTCAGATCAAAT pLKO.1 1481 CDS 100% 13.200 6.600 Y ZNF761 n/a
8 TRCN0000149130 GCTGGAGAGAAACCTTACAAA pLKO.1 3031 3UTR 100% 5.625 2.813 Y ZNF761 n/a
9 TRCN0000021908 TCAGGGATGTGGCCATAGAAT pLKO.1 258 CDS 100% 5.625 2.813 Y ZNF765 n/a
10 TRCN0000150044 CCTTGAAAGACATAGGAGAAT pLKO.1 1669 CDS 100% 4.950 2.475 Y ZNF816 n/a
11 TRCN0000146860 CGTGTGAAATCAAACCTTGAA pLKO.1 2159 CDS 100% 4.950 2.475 Y ZNF761 n/a
12 TRCN0000148307 CAATGTAATGAGAGTGGCAAA pLKO.1 875 CDS 100% 4.050 2.025 Y ZNF321P n/a
13 TRCN0000149173 CCATTGTGAATCACTGGAGAA pLKO.1 2920 3UTR 100% 4.050 2.025 Y ZNF761 n/a
14 TRCN0000148611 CGTAGACTTCATACTGGAGAA pLKO.1 2438 CDS 100% 4.050 2.025 Y ZNF761 n/a
15 TRCN0000021904 GACTCTATACAGGGACGTGAT pLKO.1 319 CDS 100% 4.050 2.025 Y ZNF765 n/a
16 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 3485 3UTR 100% 4.050 2.025 Y P3H4 n/a
17 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 3485 3UTR 100% 4.050 2.025 Y ORAI2 n/a
18 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 3485 3UTR 100% 4.050 2.025 Y P3H4 n/a
19 TRCN0000151709 CAAATGTAATGAGTGTGGCAA pLKO.1 1375 CDS 100% 2.640 1.320 Y ZNF320 n/a
20 TRCN0000021907 GCTGGAGAATTATAGGAACCT pLKO.1 340 CDS 100% 2.640 1.320 Y ZNF765 n/a
21 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 2282 CDS 100% 15.000 7.500 Y Gm10771 n/a
22 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 2282 CDS 100% 15.000 7.500 Y ZNF286B n/a
23 TRCN0000096735 GCAAGAACTTTAGTCAGAAAT pLKO.1 2316 CDS 100% 13.200 6.600 Y Zfp112 n/a
24 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1112 CDS 100% 4.950 2.475 Y ZNF28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289951.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08581 pDONR223 100% 53.3% 46.1% None (many diffs) n/a
2 ccsbBroad304_08581 pLX_304 0% 53.3% 46.1% V5 (many diffs) n/a
3 TRCN0000476486 AGTATTTAAATCGATGTCTATAAC pLX_317 30.4% 53.3% 46.1% V5 (many diffs) n/a
4 ccsbBroadEn_15256 pDONR223 64.6% 40.6% 34.6% None (many diffs) n/a
5 ccsbBroad304_15256 pLX_304 0% 40.6% 34.6% V5 (many diffs) n/a
6 TRCN0000466083 GTTTGTTCTAAACATTGCGACATC pLX_317 35.1% 25.3% 22.6% V5 (not translated due to frame shift) (many diffs) n/a
7 ccsbBroadEn_05629 pDONR223 100% 19% 15.1% None (many diffs) n/a
8 ccsbBroad304_05629 pLX_304 0% 19% 15.1% V5 (many diffs) n/a
9 TRCN0000468214 TCTCTAGTACCTCAATAGGTGGTT pLX_317 94.7% 19% 15.1% V5 (many diffs) n/a
10 ccsbBroadEn_14339 pDONR223 100% 7.5% .4% None (many diffs) n/a
11 ccsbBroad304_14339 pLX_304 0% 7.5% .4% V5 (not translated due to prior stop codon) (many diffs) n/a
12 TRCN0000478280 ACGAGTTCACTGTCATGACCAACC pLX_317 100% 7.5% .4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV