Transcript: Mouse NM_001318131.1

Mus musculus mitogen-activated protein kinase 10 (Mapk10), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Mus musculus (mouse)
Gene:
Mapk10 (26414)
Length:
6044
CDS:
7..1275

Additional Resources:

NCBI RefSeq record:
NM_001318131.1
NBCI Gene record:
Mapk10 (26414)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001318131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360388 GCGGATTCTGAGCACAATAAA pLKO_005 964 CDS 100% 15.000 21.000 N Mapk10 n/a
2 TRCN0000360389 GTATGTGGTGACGCGATATTA pLKO_005 672 CDS 100% 15.000 21.000 N Mapk10 n/a
3 TRCN0000194979 CCATTTCATGTGATCTATTAC pLKO.1 2026 3UTR 100% 13.200 18.480 N MAPK10 n/a
4 TRCN0000012633 GCGATAGAACACAGCACACAT pLKO.1 1450 3UTR 100% 4.950 6.930 N Mapk10 n/a
5 TRCN0000201207 GTTGGAACCAAGTCAACGTAT pLKO.1 5952 3UTR 100% 4.950 6.930 N Mapk10 n/a
6 TRCN0000360315 CAATAGAGAGATCCAACATAA pLKO_005 1607 3UTR 100% 13.200 10.560 N Mapk10 n/a
7 TRCN0000417287 ATGAAGTGTGTGAACCATAAA pLKO_005 349 CDS 100% 13.200 9.240 N MAPK10 n/a
8 TRCN0000191064 CCAAGTCAACGTATTGTAATT pLKO.1 5959 3UTR 100% 13.200 9.240 N Mapk10 n/a
9 TRCN0000012634 CGAAGAATGGAAAGAACTTAT pLKO.1 1167 CDS 100% 13.200 9.240 N Mapk10 n/a
10 TRCN0000216662 CTCAACCTTCACCGTTCTTAA pLKO.1 171 CDS 100% 13.200 9.240 N Mapk10 n/a
11 TRCN0000196370 GACAGAAATGTGGCCATTAAG pLKO.1 265 CDS 100% 13.200 9.240 N MAPK10 n/a
12 TRCN0000012636 GTGTCATCTATTGCCAAACAT pLKO.1 94 CDS 100% 5.625 3.938 N Mapk10 n/a
13 TRCN0000012637 CAAGTCTGATTGCACACTGAA pLKO.1 597 CDS 100% 4.950 3.465 N Mapk10 n/a
14 TRCN0000012635 CCAAGATGTCTACTTAGTGAT pLKO.1 423 CDS 100% 4.950 3.465 N Mapk10 n/a
15 TRCN0000432277 GCCTAGTCAGATGGATGTAGA pLKO_005 1906 3UTR 100% 4.950 3.465 N MAPK10 n/a
16 TRCN0000191558 GAATCATTAAAGCTGAAGGAA pLKO.1 5992 3UTR 100% 3.000 2.100 N Mapk10 n/a
17 TRCN0000001020 GCCATTAAGAAGCTCAGCAGA pLKO.1 277 CDS 100% 2.640 1.848 N MAPK10 n/a
18 TRCN0000001938 GCCATTAAGAAGCTCAGCAGA pLKO.1 277 CDS 100% 2.640 1.848 N MAPK10 n/a
19 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3441 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491457 CCGTCCACGCTTTTACTCGGCAGT pLX_317 24.4% 89.1% 97.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000492117 CTAAGCTAACTACGGCGGTACGCC pLX_317 31.1% 89% 97.6% V5 (many diffs) n/a
3 TRCN0000487812 TGCAGATTATTTTACTCCTCGACG pLX_317 20.5% 80.9% 97.8% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488648 ACCAGGGTGAGTGAATCTAAGAAG pLX_317 20.3% 80.8% 97.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_11058 pDONR223 100% 53.1% 57.9% None (many diffs) n/a
6 ccsbBroad304_11058 pLX_304 0% 53.1% 57.9% V5 (many diffs) n/a
7 TRCN0000475774 GTGAGTTGCCAATCATGCAATTTA pLX_317 29% 53.1% 57.9% V5 (many diffs) n/a
8 ccsbBroadEn_11057 pDONR223 100% 51.4% 57.1% None (many diffs) n/a
9 ccsbBroad304_11057 pLX_304 0% 51.4% 57.1% V5 (many diffs) n/a
10 TRCN0000468220 CCCGCTATCGAACCGGGCATATAA pLX_317 45% 51.4% 57.1% V5 (many diffs) n/a
11 ccsbBroadEn_14805 pDONR223 0% 51.4% 57.1% None (many diffs) n/a
12 ccsbBroad304_14805 pLX_304 0% 51.4% 57.1% V5 (many diffs) n/a
13 TRCN0000466133 TCATAAGCAAACAGGTTCCCACAG pLX_317 29.1% 51.4% 57.1% V5 (many diffs) n/a
Download CSV