Construct: ORF TRCN0000466133
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005216.2_s317c1
- Derived from:
- ccsbBroadEn_14805
- DNA Barcode:
- TCATAAGCAAACAGGTTCCCACAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MAPK10 (5602)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466133
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008447.2 | 100% | 100% | |
2 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008448.2 | 100% | 100% | |
3 | human | 5602 | MAPK10 | mitogen-activated protein k... | NM_001318068.1 | 96.8% | 97.4% | (many diffs) |
4 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008449.2 | 96.8% | 97.4% | (many diffs) |
5 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008450.2 | 96.8% | 97.4% | (many diffs) |
6 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454148.1 | 96.8% | 97.4% | (many diffs) |
7 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008445.2 | 91.1% | 91.1% | 1_93del |
8 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008452.2 | 85.8% | 85.2% | 815_819delCAGCA;831_832ins131 |
9 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008451.2 | 78.2% | 77.7% | 1_93del;908_912delCAGCA;924_925ins131 |
10 | human | 5602 | MAPK10 | mitogen-activated protein k... | NM_001351624.2 | 74.8% | 74.8% | 1_321del |
11 | human | 5602 | MAPK10 | mitogen-activated protein k... | NM_138980.4 | 74.8% | 74.8% | 1_321del |
12 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_006714268.3 | 74.8% | 74.8% | 1_321del |
13 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_011532120.3 | 74.8% | 74.8% | 1_321del |
14 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_011532121.3 | 74.8% | 74.8% | 1_321del |
15 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008423.2 | 74.8% | 74.8% | 1_321del |
16 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008427.2 | 72.6% | 73% | (many diffs) |
17 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008428.2 | 72.6% | 73% | (many diffs) |
18 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008433.2 | 69.2% | 69% | 1_321del;616_617ins72 |
19 | human | 5602 | MAPK10 | mitogen-activated protein k... | NM_138982.4 | 68.7% | 68.7% | 1_435del |
20 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_005263129.3 | 68.7% | 68.7% | 1_435del |
21 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_005263130.3 | 68.7% | 68.7% | 1_435del |
22 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_011532117.3 | 68.7% | 68.7% | 1_435del |
23 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_011532118.3 | 68.7% | 68.7% | 1_435del |
24 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008420.2 | 68.7% | 68.7% | 1_435del |
25 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454139.1 | 68.7% | 68.7% | 1_435del |
26 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454140.1 | 68.7% | 68.7% | 1_435del |
27 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454141.1 | 68.7% | 68.7% | 1_435del |
28 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454142.1 | 68.7% | 68.7% | 1_435del |
29 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454143.1 | 68.7% | 68.7% | 1_435del |
30 | human | 5602 | MAPK10 | mitogen-activated protein k... | NM_001318067.1 | 66.7% | 67% | (many diffs) |
31 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_005263131.3 | 66.7% | 67% | (many diffs) |
32 | human | 5602 | MAPK10 | mitogen-activated protein k... | NM_001318069.2 | 66.7% | 68.7% | 1_435del;1393_1434del |
33 | human | 5602 | MAPK10 | mitogen-activated protein k... | NM_001351625.2 | 64.3% | 63.8% | 1_321del;1136_1140delCAGCA;1152_1153ins131 |
34 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008434.2 | 64.3% | 63.8% | 1_321del;1136_1140delCAGCA;1152_1153ins131 |
35 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008435.2 | 64.3% | 63.8% | 1_321del;1136_1140delCAGCA;1152_1153ins131 |
36 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008436.2 | 64.3% | 63.8% | 1_321del;1136_1140delCAGCA;1152_1153ins131 |
37 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008437.2 | 64.3% | 63.8% | 1_321del;1136_1140delCAGCA;1152_1153ins131 |
38 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008422.2 | 63.5% | 63.3% | 1_435del;730_731ins72 |
39 | human | 5602 | MAPK10 | mitogen-activated protein k... | NM_001363657.2 | 62.2% | 61.9% | (many diffs) |
40 | human | 5602 | MAPK10 | mitogen-activated protein k... | NM_002753.5 | 59.1% | 58.6% | 1_435del;1250_1254delCAGCA;1266_1267ins131 |
41 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_005263135.4 | 59.1% | 58.6% | 1_435del;1250_1254delCAGCA;1266_1267ins131 |
42 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008429.2 | 59.1% | 58.6% | 1_435del;1250_1254delCAGCA;1266_1267ins131 |
43 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008430.2 | 59.1% | 58.6% | 1_435del;1250_1254delCAGCA;1266_1267ins131 |
44 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008432.2 | 59.1% | 58.6% | 1_435del;1250_1254delCAGCA;1266_1267ins131 |
45 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454144.1 | 59.1% | 58.6% | 1_435del;1250_1254delCAGCA;1266_1267ins131 |
46 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454145.1 | 59.1% | 58.6% | 1_435del;1250_1254delCAGCA;1266_1267ins131 |
47 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454146.1 | 59.1% | 58.6% | 1_435del;1250_1254delCAGCA;1266_1267ins131 |
48 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454147.1 | 59.1% | 58.6% | 1_435del;1250_1254delCAGCA;1266_1267ins131 |
49 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323328.2 | 58.8% | 67.9% | (many diffs) |
50 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323329.2 | 58.8% | 67.9% | (many diffs) |
51 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323331.2 | 58.8% | 67.9% | (many diffs) |
52 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_139049.4 | 58.8% | 67.9% | (many diffs) |
53 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008441.2 | 58.7% | 57.9% | (many diffs) |
54 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_006714269.3 | 57.1% | 56.8% | (many diffs) |
55 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323302.2 | 52% | 59.1% | (many diffs) |
56 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323324.2 | 52% | 59.1% | (many diffs) |
57 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323326.2 | 52% | 59.1% | (many diffs) |
58 | human | 5599 | MAPK8 | mitogen-activated protein k... | NM_001323327.2 | 52% | 59.1% | (many diffs) |
59 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008453.2 | 22.3% | 21.3% | (many diffs) |
60 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008454.2 | 21.3% | 21.1% | 1_435del;731_732delGAinsTG;735_735delGins658 |
61 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454149.1 | 21.3% | 21.1% | 1_435del;731_732delGAinsTG;735_735delGins658 |
62 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | XM_011249450.3 | 74.2% | 81.7% | (many diffs) |
63 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | XM_030254518.1 | 72% | 80% | (many diffs) |
64 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | NM_001310683.1 | 67.9% | 74.8% | (many diffs) |
65 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | XM_017320888.2 | 67.9% | 74.8% | (many diffs) |
66 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | XM_017320889.2 | 65.9% | 73.2% | (many diffs) |
67 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | NM_001081567.2 | 62.4% | 68.7% | (many diffs) |
68 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | XM_030254516.1 | 62.4% | 68.7% | (many diffs) |
69 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | NM_001310685.1 | 60.6% | 67.2% | (many diffs) |
70 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | XM_017320886.2 | 60.6% | 67.2% | (many diffs) |
71 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | NM_001318102.1 | 60.5% | 68.7% | (many diffs) |
72 | mouse | 26419 | Mapk8 | mitogen-activated protein k... | NM_001310454.1 | 59.3% | 67.6% | (many diffs) |
73 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | NM_001310686.2 | 57.9% | 63.8% | (many diffs) |
74 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | XM_017320890.2 | 57.9% | 63.8% | (many diffs) |
75 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | XM_017320891.2 | 57.9% | 63.8% | (many diffs) |
76 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | XM_030254519.1 | 56% | 62.2% | (many diffs) |
77 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | NM_009158.3 | 53.2% | 58.6% | (many diffs) |
78 | mouse | 26419 | Mapk8 | mitogen-activated protein k... | NM_016700.4 | 52% | 59.1% | (many diffs) |
79 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | NM_001318131.1 | 51.4% | 57.1% | (many diffs) |
80 | mouse | 26414 | Mapk10 | mitogen-activated protein k... | XM_006534950.4 | 51.4% | 57.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1023
- ORF length:
- 957
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga actgatggat gccaacttat gtcaagtgat tcagatggaa ttagaccatg 121 agcgaatgtc ttacctgctg taccaaatgt tgtgtggcat taagcacctc cattctgctg 181 gaattattca cagggattta aaaccaagta acattgtagt caagtctgat tgcacattga 241 aaatcctgga ctttggactg gccaggacag caggcacaag cttcatgatg actccatatg 301 tggtgacacg ttattacaga gcccctgagg tcatcctggg gatgggctac aaggagaacg 361 tggatatatg gtctgtggga tgcattatgg gagaaatggt tcgccacaaa atcctctttc 421 caggaaggga ctatattgac cagtggaata aggtaattga acaactagga acaccatgtc 481 cagaattcat gaagaaattg caacccacag taagaaacta tgtggagaat cggcccaagt 541 atgcgggact caccttcccc aaactcttcc cagattccct cttcccagcg gactccgagc 601 acaataaact caaagccagc caagccaggg acttgttgtc aaagatgcta gtgattgacc 661 cagcaaaaag aatatcagtg gacgacgcct tacagcatcc ctacatcaac gtctggtatg 721 acccagccga agtggaggcg cctccaccTC AGATATATGA CAAGCAGTTG GATGAAAGAG 781 AACACACAAT TGAAGAATGG AAAGAACTTA TCTACAAGGA AGTAATGAAT TCAGAAGAAA 841 AGACTAAAAA TGGTGTAGTA AAAGGACAGC CTTCTCCTTC AGGTGCAGCA GTGAACAGCA 901 GTGAGAGTCT CCCTCCATCC TCGTCTGTCA ATGACATCTC CTCCATGTCC ACCGACCAGA 961 CCCTGGCATC TGACACTGAC AGCAGCCTGG AAGCCTCGGC AGGACCCCTG GGTTGTTGCA 1021 GGTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1081 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1141 GGCTTTATAT ATCTTGTGGA AAGGACGATC ATAAGCAAAC AGGTTCCCAC AGACGCGTTA 1201 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt