Transcript: Human NM_001351670.2

Homo sapiens zinc finger protein 100 (ZNF100), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ZNF100 (163227)
Length:
5592
CDS:
151..1680

Additional Resources:

NCBI RefSeq record:
NM_001351670.2
NBCI Gene record:
ZNF100 (163227)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351670.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235915 GTTAGGCATTCAGAGTAATAT pLKO_005 2930 3UTR 100% 15.000 21.000 N ZNF100 n/a
2 TRCN0000020830 GCACAAAGAACATGATAACAA pLKO.1 522 CDS 100% 5.625 7.875 N ZNF100 n/a
3 TRCN0000235914 CAGTCCCTAAGCCTTATTAAA pLKO_005 1621 CDS 100% 15.000 10.500 N ZNF100 n/a
4 TRCN0000020831 CCAGTCCCTAAGCCTTATTAA pLKO.1 1620 CDS 100% 15.000 10.500 N ZNF100 n/a
5 TRCN0000235913 AGTGCACAAAGAACATGATAA pLKO_005 519 CDS 100% 13.200 9.240 N ZNF100 n/a
6 TRCN0000235917 GAGTTTGTGTGTATGAATTTG pLKO_005 4043 3UTR 100% 13.200 9.240 N ZNF100 n/a
7 TRCN0000020829 CCCTAAGCCTTATTAAACAAA pLKO.1 1625 CDS 100% 5.625 3.938 N ZNF100 n/a
8 TRCN0000020833 CCTCACAACTAACTGCACATA pLKO.1 1457 CDS 100% 4.950 3.465 N ZNF100 n/a
9 TRCN0000235916 AGTCTTCTGGTGCAGTCTTAT pLKO_005 217 CDS 100% 13.200 7.920 N ZNF100 n/a
10 TRCN0000236731 ACCTTACTACACATAAGATAA pLKO_005 875 CDS 100% 13.200 6.600 Y ZNF98 n/a
11 TRCN0000236730 CCCTTACTACACATAAGATAA pLKO_005 1127 CDS 100% 13.200 6.600 Y ZNF98 n/a
12 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 818 CDS 100% 13.200 6.600 Y Zfp934 n/a
13 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 818 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
14 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 818 CDS 100% 13.200 6.600 Y EG668616 n/a
15 TRCN0000421971 TTACACCTAACTCAACATAAA pLKO_005 703 CDS 100% 13.200 6.600 Y ZNF430 n/a
16 TRCN0000165774 CCTCCTAAGTAGCTGGGATTA pLKO.1 3414 3UTR 100% 10.800 5.400 Y SNX29P1 n/a
17 TRCN0000149130 GCTGGAGAGAAACCTTACAAA pLKO.1 1153 CDS 100% 5.625 2.813 Y ZNF761 n/a
18 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 339 CDS 100% 4.950 2.475 Y ZNF493 n/a
19 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1159 CDS 100% 4.950 2.475 Y ZNF28 n/a
20 TRCN0000149073 GCAAAGCCTTTAACCAGTCTT pLKO.1 1103 CDS 100% 4.950 2.475 Y ZNF714 n/a
21 TRCN0000149336 GCAAAGGCTTTAACTGGTCTT pLKO.1 1271 CDS 100% 4.050 2.025 Y ZNF714 n/a
22 TRCN0000019028 GCCTTTAACCAGTCCTCAATT pLKO.1 1108 CDS 100% 13.200 6.600 Y ZNF92 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351670.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15273 pDONR223 50.9% 93.7% 93.7% None 222_223ins99;1067C>T;1500C>T n/a
2 ccsbBroad304_15273 pLX_304 0% 93.7% 93.7% V5 222_223ins99;1067C>T;1500C>T n/a
3 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 42.3% 42.4% V5 (not translated due to frame shift) 222_223ins99;690_1527del n/a
4 ccsbBroadEn_15167 pDONR223 53.6% 80.7% 36.7% None (many diffs) n/a
5 ccsbBroad304_15167 pLX_304 0% 80.7% 36.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_09784 pDONR223 100% 77.2% 69.4% None (many diffs) n/a
7 ccsbBroad304_09784 pLX_304 0% 77.2% 69.4% V5 (many diffs) n/a
8 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 77.2% 69.4% V5 (many diffs) n/a
9 ccsbBroadEn_11232 pDONR223 100% 64.5% 53.7% None (many diffs) n/a
10 ccsbBroad304_11232 pLX_304 0% 64.5% 53.7% V5 (many diffs) n/a
11 TRCN0000476048 TACTATCCCAATAGAAACACCTCC pLX_317 21.8% 64.5% 53.7% V5 (many diffs) n/a
12 ccsbBroadEn_09774 pDONR223 100% 64.3% 54% None (many diffs) n/a
13 ccsbBroad304_09774 pLX_304 0% 64.3% 54% V5 (many diffs) n/a
14 TRCN0000472815 CCTGACTCCCTTTAAGTGTTCGTG pLX_317 27.4% 64.3% 54% V5 (many diffs) n/a
15 ccsbBroadEn_11235 pDONR223 100% 29% 22.9% None (many diffs) n/a
16 ccsbBroad304_11235 pLX_304 0% 29% 22.9% V5 (many diffs) n/a
17 TRCN0000481650 TTTATCAAAGGAATCCCCAATTTT pLX_317 100% 29% 22.9% V5 (many diffs) n/a
Download CSV